| ID | Sequence | Length | GC content |
|---|---|---|---|
| DIO3OS:9 | CGUUCGUCCCCGGACGUUGCUCUCUACCCCGGGAACGUCGAGACUGGAG… | 1068 nt | 0.6339 |
The mouse and human DIO3OS and DIO3 (MIM 601038) genes overlap and are transcribed in opposite directions. The mouse Dio3 gene is imprinted from the paternal allele during fetal development, suggesting that DIO3OS is a noncoding gene that may have a role in maintaining monoallelic expression of DIO3 (Hernandez et al., 2004 [PubMed 14962667]).[supplied by OMIM, Mar 2008]
A study in mice demonstrated that the DIO3OS was identified as a significantly downregulated RNA marker (0.512-fold reduction) in lung tissue following hypothermia-induced death, classifying it as a candidate forensic biomarker for this condition [Takamiya et al. DOI:10.1016/J.Legalmed.2020.101789].