| ID | Sequence | Length | GC content |
|---|---|---|---|
| lnc-RNASEH2B-4:1 | GACAGGAAAGGGGUUCUAUCCAUGAUCUUACAAUUCCUAAACAGCAACA… | 1723 nt | 0.4689 |
No relevant information is available at the moment.
A study in human patients identified DLEU1 as the most up-regulated long non-coding RNA in acute myocardial infarction (AMI) through RNA sequencing of peripheral blood samples, a finding supported by subsequent qRT-PCR validation [Wang et al. DOI:10.2147/IJGM.S329391]. A study in cultured human aortic endothelial cells demonstrated that the lnc-RNASEH2B-4 was identified as a radiation-responsive long non-coding RNA, serving as a '0 Gy marker' that could differentiate unirradiated samples from those exposed to X-ray doses of 1-10 Gy at the 24-hour post-radiation time point [Chopra et al. DOI:10.1038/s41598-022-24051-6].