| ID | Sequence | Length | GC content |
|---|---|---|---|
| ZEB2-AS1:9 | GCUGUGCCUCGAGGAUUAGUUUAAACAGGGGGCUAUAAAAGAUGUAACA… | 1187 nt | 0.4617 |
This gene produces a spliced long non-coding RNA which is a natural antisense transcript corresponding to the 5' UTR of zinc finger E-box binding homeobox 2 (ZEB2). It is thought that this transcript may be involved in the regulation of ZEB2 expression, and may play a role in the progression of bladder cancer. [provided by RefSeq, Aug 2015]
A review of long non-coding RNAs in mammals, including humans and mice, synthesized findings that the ZEB2-AS1 complements the 5′ splice site of an intron in the 5′ UTR of Zeb2 mRNA, preventing splicing and allowing translation via an internal ribosome entry site (IRES) in the retained intron [Mercer et al. DOI:10.1038/nrg2521].