Basic Information
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| HOTAIR:9 | AGACCAACACCCCUGCUCCUGGCGGCUCCCACCCGGGACUUAGACCCUC… | 562 nt | 0.5445 |
Summary
This gene is located within the Homeobox C (HOXC) gene cluster on chromosome 12 and is co-expressed with the HOXC genes. It functions through an RNA product, which binds lysine specific demethylase 1 (LSD1) and Polycomb repressive complex 2 (PRC2), and serves as a scaffold to assemble these regulators at the HOXD gene cluster, thereby promoting epigenetic repression of HOXD. This gene is highly expressed in multiple tumors. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Feb 2019]
Forensic Context
A study in humans demonstrated that the HOTAIR demarcates active and silent chromatin domains in HOX loci [Mattick et al. DOI:10.1038/s41580-022-00566-8]. A review of long non-coding RNAs (lncRNAs) in mammals and other eukaryotes, including human and mouse, describes the HOTAIR as originating from the HOXC locus and functioning to silence transcription across 40 kb of the HOXD locus in trans by recruiting the Polycomb chromatin remodelling complex PRC2 to induce a repressive chromatin state [Mercer et al. DOI:10.1038/nrg2521].