| ID | Sequence | Length | GC content |
|---|---|---|---|
| HOTAIRM1:9 | AAACAGGUUUAAGAAUGAAAUAUUGAUUUUUCUGACCCUGAAAAAAAAA… | 647 nt | 0.3555 |
This non-coding locus is located in the HOX gene cluster. Transcription of this locus is induced by retinoic acid, and transcripts likely function in regulation of myelopoiesis through transcriptional activation of several genes in the HOXA cluster, in addition to several beta-2 integrins. [provided by RefSeq, Jan 2013]
A study in human postmortem midbrain specimens from chronic cocaine abusers identified the HOTAIRM1 as an up-regulated long noncoding RNA, with a 1.53-fold increase in expression compared to well-matched control subjects [Bannon et al. DOI:10.1111/jnc.13255]. A separate review also lists the HOTAIRM1 as a biomarker detected in circulating PBMCs of Parkinson's disease patients [Das et al. DOI:10.1080/21655979.2021.2003667].