| ID | Sequence | Length | GC Content |
|---|---|---|---|
| NM_001511.4 | ACAGAGCCCGGGCCGCAGGCACCUCCUCGCCAGCUCUUCCGCUCCUCUC… | 1174 nt | 0.4540 |
This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Sep 2014]
No forensic context available.