Basic Information

Symbol
CXCL1
RNA Class
mRNA
Alias
C-X-C motif chemokine ligand 1 SCYB1 GROa MGSA-a NAP-3 melanoma growth stimulating activity, alpha GRO1 oncogene (melanoma growth stimulating activity, alpha) fibroblast secretory protein chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) FSP GRO1 MGSA growth-regulated alpha protein C-X-C motif chemokine 1 GRO-alpha(1-73) GRO1 oncogene (melanoma growth-stimulating activity) MGSA alpha melanoma growth stimulatory activity alpha neutrophil-activating protein 3 GRO GROA Growth-regulated alpha protein Melanoma growth stimulatory activity Neutrophil-activating protein 3
Location (GRCh38)
4:73869392-73871308 UCSC Genome Browser

Secondary Structure

MANE Select
NM_001511.4
Sequence length
1174 nt
GC Content
0.4540

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-336.4 kcal/mol
Thermodynamic ensemble
Free Energy: -361.3 kcal/mol
Frequency: 0.0000
Diversity: 320.75
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((((...))).))(((((.(((((((((....((((((..(((..(((((((.(.(((((((.((.((..((((.((((((((......((((..............))))....(((((((((...)))))))..))....))))).))).)))))).)).))))))).).)))..))))..)))......((((((((((..(((((...)))))(((.......)))....((((.....))))....(((..((((...))))..)))(.((((((......(((.........)))......)))))).).(((((.((((..((((.......................((((.....))))(((..((((..........))))..)))..)))).)))))))))))))))))))((((((((.(((.(((...)))))).))))))))..)))))))))))(((((((...(((.(..((....))..).)))....)))))))((((...))))(((((....)))))..............(((..((((((.....(((((((.(((((...(((((((...........(((((.((.....))))))))))).)))...))))).....(((((((.(((((((((((((((...((.((((....(((((((.......(((((((((.......)))))))))(((((.(((....(((....)))...))).))))).........(((((((.(((...))).)))))))))))))).......(((((..((((.((((((((((((((((((((((.((..(((((((((...((...(((((.((((((((........)))))))).)))))))...)))).)))))..))))))))))).)))..........(((((......)))))((((.(((...))).))))((((((((......))))))))(((((.........))))))))))))))))))))))))..)))))).))))........)))))).))))).)))))))................)))))))))))))....)))...))))))))).....)))))....((((((((...))))))))............
Thermodynamic Ensemble Prediction
....((((((((((...))).}},((((,{((((({((.{..(((((({.,{({{(({{({,.{,((({{{{.({,{{.,((((,(((((((({,,,,.(({(,...{(({......,|||{{,.{,|{|{{|{,..}}})||,,.)),...))}))}})).))})))})},))))))),)})}).})))),,})}....,,(((((((((({{(((((...)))))||{..,{{{{,,...,.,,,{.....},))},,.(((..((((...))))..))){.((((((......{({.........)))...,..)))))).}.(((((.((((..((((.......................((((.....))))(((..((((..........))))..))).,)))}.)))))))))))))))))))((((((((.(((.(((...)))))).))))))))}.,)))))..)})))|,,||}},}|,}|}}||....|{{{|{{|({{,,,||||,{,{{{...))))))}(({{{(((((.....,..............,,....)))))))))...,{{(((({{((,,..}}}}}},.}},,(((((.({.....)))))))}}})},.)})}...,,,,,,,{{(({{,.{(((((((({{((((...{{.((((....(((((((.......(((((((((,....,,}))))))))(((((.(((....(((....)))...))).))))).........(((((((.(({...})).)))))))))))))).......(((((..((((.((((((((({{(((((((((((.{{.,((((,((((...{.,,.,((({.((((((((........)))))))).})))}.},.,)))),)))))..||))))))))).)))},........(((((......))))),{|,.|||.,,))}.}}},{(((((((......)))))))|(((((.........))))))))))))))))))))))))..)))).},)))),,......}}}}|||||||}.}))))))}}||,|||.||||.,,,...........,,},}},}}}))))))))},.....)))))....{(((((({...})))))))............

Transcripts

ID Sequence Length GC Content
NM_001511.4 ACAGAGCCCGGGCCGCAGGCACCUCCUCGCCAGCUCUUCCGCUCCUCUC… 1174 nt 0.4540
Summary

This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Sep 2014]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image