Basic Information

Symbol
F12
RNA Class
mRNA
Alias
coagulation factor XII Plasma coagulation Factor XIIa coagulation factor XII (Hageman factor) HAE3 HAEX HAF Hageman factor beta-factor XIIa part 1 beta-factor XIIa part 2 coagulation factor XIIa heavy chain coagulation factor XIIa light chain Coagulation factor XII EC 3.4.21.38 EC 3.4.21
Location (GRCh38)
5:177402133-177416583 UCSC Genome Browser

Secondary Structure

MANE Select
NM_000505.4
Sequence length
2036 nt
GC Content
0.6498

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-890.6 kcal/mol
Thermodynamic ensemble
Free Energy: -923.2 kcal/mol
Frequency: 0.0000
Diversity: 636.87
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((...((.((((((.((...(((((((.((..((.(((((.((((((..((.(((((((((((((((....(((((((.........)))))))(((((((.....)))))))(((...........)))..(((((........))))).((((.....((((((........))))))....))))..))))))))((((...................((((((.....))))))))))..(((((...))))).(((((.(.(((........))).).))))).........))))))).))..((((......)))))))))).((((((.((((.((.....))))))..))))))......((...))))))).))..)).)))))))....(((((((((((((((((......((((((..(((.((((((((.((((((((((.((((((.(((.............)))...))))))))).))))(((((.(((.(((.(((.((((((((((...((.((.(((.(((((((.(((((..(((((((..((.(((((..((((((....))))))))).)).)).....(((((....)))))))))).))....((((((((.....)))))).)).(((((.(.((.(((.....((((..((((((.....((((((((.........))))))))((((((((.(((((((..((((.....))))..)).))))).)))....)))))....((((..((((..(((((.((..((((((..((((((((.(((((....)))))...(((((....((((...((....((((((((((((((((..(((.(.(((....))).).)))..)))))))))))..((((((...))))))...........)))))))..))))...))))))))))).))....((((.......)))).)))))).)))))))..((.((....)).)).))))..))))..(((((.((..((((.......))))(((.....))))).))))))))))).))))))).)).))))))(((((.(((..(((((.((...(((((........((((((((..(((((.....)))))..)))))))).(((((.(((((((.((((...........)))).))).))...)).))))).(((((((.(((((((.(.((.(((...(((..(((((((....(((((.((.(((....))))).))))).))))))))))...))).)).).))).))))))))))))))))..)).)))))))).)))))))))).))))))).))).))))..))).)))))))..)))..))).)))...)))))....(((((.((.((((..((.((((.((((((.(((.(.((((((.(.((((((.(((((((.............((((((((..((....))..)))))).))...((((((...((.(.(((.((..(((((((......))))))).))..))).)))))))))................))))))))))))).).)))))))))).)))))))))).))..))))..)).)))))..((((((.......((((((((..(((((((((..(((.((((....(((.(((((..(((.(((.(((....)))...))).))))))))))))))))))..)).)))))))(((.((.......))..))).......))))))))...((((((((...))))....))))..(((((......)))))((((........)))).))))))((((((.....)))))))))..)))))))))))..))))))......))))..))))..))))))...)))(((((((.((((.(.(((....))).).))))..)))))))..))))))))))...)))))).(((((..............))))).............
Thermodynamic Ensemble Prediction
..((((((...((.((((((.((...(((((((.((..((.(((({.((((((,.((.((((((({(((((((,{,,(((((((.........)))))))(((((((.....))))))),{{....,......|||,.,{|||...,,,,.}}}}}}||||},,,,((((((........}}))))}...,|||{,||||||},((((,,,.......||,,.....((((((.....))))))}))).}}|||}}}}}.,,..(((((.(.(((........))).).))))).........))))))).})..((((......)))))))))}.((((((.((((.((.....))))))..))))))......||...)}))))).))..)).)))))))....({(((((((((((((((..,...((((((..(((.((((((((.(({(((((({{((((((.(({.............)))...))))))))).))))((((({(((,{{{.{((,((((({((((,,,(,.((.{{{.((({((({(,((((.....|||}.|}}|},,,..((((((....))))))|||.||{||{{.,.(((((....}}}))||||(((((((.{({((({(,,,..}}}})),)),,.,,},,..)))).))),.}))),.}},})}.,,.,((((((((,{,,,{,,,|}|||}||{||||||,|||{{,,{{,,(((((((((((((,(((,((((((({((((((,..}}}.}|||...,,,..,((((.(({{(({(((..(((((((((((((((....,,,...{(((((...)))).)}..,...{(((..(((((.(((.,{.(((...,,(((.({(((((,({.(((|||..|{.{,,((((({...}))))).......{(.(((.((((((.........)))))).))).))...,,,|}}.},..}}},))))),))))))),..))).}.)))}..})))))))...)))}..})))).))))))),}.,,}})|}.|{|}}|||||}(({((((......)))},}||({{....})),..)))))}).(((((((.....))))))){{{...((((((((..(((((.....)))))..)))))))).||}}|}}}..})|}||}}}})))......,|||||||,}}|}||}}}}},)))}|||||}||||||||{,{{,{{||..{{{..||||||{,,..(((((.((.(((....))))).))))),))))))))))....},,}))))),)},)))))))..}|||}}..,,.{|||||||||||}||}}||.}||}|||,|}|,||||..}}}.|}||}}|..||}..})).)}}|,,|}}}}....(((((.((.((((..((.((({{((((((.(((.(.((((((.(.((((((.(((((((,({,....,,,,,(({(((({{{(({,,.,},}))}}|}.|},||({{({(.,.{{.{.|||.|,..|||{|||,,,...))))))).)}..))),)))))}|||.........,.,,,},))))))))))))).).)))))))))).)))))))))).))..))))..)).))))).,(({{((,,,..,.{(((((((,,(((((((((..((,,({{{..,.||,|{{{{|,.|||,|||.|||.,,.,}},,,))},))))))))})))))))))..)).)))))))|||}||,.,,.,})),.))).}},.,}))))))},.,,|||{((((,..))))}.,..|||,|({(((,,,,..}})))||{{.....}}})))}.)||||}((((((.....))))))}))..)))))))))))..))))))......))))..))))..))))))...)))(((((((.((((.(.(((....})).).))))..)))))))..))))))))))...)))))).{{{(({,....{,,,....}},},}}},...,,},..

Transcripts

ID Sequence Length GC Content
NM_000505.4 ACUCCUGGAUAGGCAGCUGGACCAACGGACGGAUGCCAUGAGGGCUCUG… 2036 nt 0.6498
Summary

This gene encodes coagulation factor XII which circulates in blood as a zymogen. This single chain zymogen is converted to a two-chain serine protease with an heavy chain (alpha-factor XIIa) and a light chain. The heavy chain contains two fibronectin-type domains, two epidermal growth factor (EGF)-like domains, a kringle domain and a proline-rich domain, whereas the light chain contains only a catalytic domain. On activation, further cleavages takes place in the heavy chain, resulting in the production of beta-factor XIIa light chain and the alpha-factor XIIa light chain becomes beta-factor XIIa heavy chain. Prekallikrein is cleaved by factor XII to form kallikrein, which then cleaves factor XII first to alpha-factor XIIa and then to beta-factor XIIa. The active factor XIIa participates in the initiation of blood coagulation, fibrinolysis, and the generation of bradykinin and angiotensin. It activates coagulation factors VII and XI. Defects in this gene do not cause any clinical symptoms and the sole effect is that whole-blood clotting time is prolonged. [provided by RefSeq, Jul 2008]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image