Basic Information

Symbol
HBA2
RNA Class
mRNA
Alias
hemoglobin subunit alpha 2 HBA-T2 hemoglobin, alpha 2 ECYT7 HBH hemoglobin subunit alpha alpha globin alpha-2 globin hemoglobin alpha chain mutant hemoglobin alpha 2 globin chain Hemoglobin subunit alpha Alpha-globin Hemoglobin alpha chain
Location (GRCh38)
16:172876-173710 UCSC Genome Browser

Secondary Structure

MANE Select
NM_000517.6
Sequence length
576 nt
GC Content
0.6441

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-219.2 kcal/mol
Thermodynamic ensemble
Free Energy: -228.92 kcal/mol
Frequency: 0.0000
Diversity: 124.08
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((((......))).))))((((...(((....)))...))))(((((.((.((((.....(((((((((((((((...(((((((.(.((.....((.((((((((((.(..((....(((.((((...)))).)))...))..)))))).....))))).)))).).)))))))((((....))))..))))))).(((((((...(((((.(((.((((.(((.((........))))))))((.(((((.(.....).)).))).)).((((((((.((((....(((....)))...)))).))))))))..(((((.(.....(((((.((((((.(((((((.(((((.(.((((.............)))).).)))))...)))).))).........(((.....)))))))))..).)))).....).)))))..................((((...(((...)))...)))).(((((.((((...)))).))))).......)))).)))))...)))))))...)).)))))).....))))..)).)))))..
Thermodynamic Ensemble Prediction
.,{{.(((((((......))).))))|||,,,{{{,...}))}...}}},(((((.((.((((.....(((((((((((((((,,.(((((((.(.({..,..((.((((((((((.((.((....(((.((((...)))).)))..,))).,))))).....))))).)))).}.}))))))((((....)))),,))))))).{((((((...(((((.(((.(({{{{((.({|,..,...||||}||}((.{((((.,....,),)),,)).)).((((((((.((((....(((....)))...)))).))))))))..(((((.{.....(((((.((((((.(((((((.(((((.(.((((.,...........)))).).)))))...)))).))).,,,.....||{.....}}}))))))..).)))).....}.))))),,.............,,,||||...|||,,,))),..)}}).(((((.((((...)))).)))))......,,))).)))))...))))))}...))))))})).....))))..)).)))))..

Transcripts

ID Sequence Length GC Content
NM_000517.6 ACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCACCAUGGUGCUGUCU… 576 nt 0.6441
Summary

The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image