Basic Information

Symbol
HLA-DQA2
RNA Class
mRNA
Alias
major histocompatibility complex, class II, DQ alpha 2 DC-alpha DQA1 DX-ALPHA HLA-DCA HLA-DXA HLADQA2 HLA class II histocompatibility antigen, DQ alpha 2 chain DC-1 alpha chain DX alpha chain HLA class II histocompatibility antigen, DQ alpha 1 chain HLA class II histocompatibility antigen, DQ(6) alpha chain MHC class I antigen MHC class II DQA1 MHC class II DQA2 MHC class II antigen HLA-DQA1
Location (GRCh38)
6:32741391-32747198 UCSC Genome Browser

Secondary Structure

MANE Select
NM_020056.5
Sequence length
1458 nt
GC Content
0.4698

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-421.6 kcal/mol
Thermodynamic ensemble
Free Energy: -448.13 kcal/mol
Frequency: 0.0000
Diversity: 283.66
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((...((((.(..(((((...)))))..)))))..((((((.........))))))....)))(((((((.(.(((((....))))).)..(((((..((((((((...((((((...(((((.((.....)).)))))))))))...)).(((((((......))).))))((((.....)))).......((((.......))))....((((.((((....((((((((((.......(((..((.((((((((.(((...((..((((((.....(((..(((((((((((.((((((((.((((((((((((.((((((((.(((((((((.....((((((((((((.....((((((((((((.....((((((..((((.(((((((.(............))))))))(((((.((((...((((((.((...(((((...)))))..............(((((....))))).((((((((.........))))))))..)).)))))).))))..)))))....(((..(((((.((....)).)))))..)))))))..)))))).....(((((((.(((..((((...))))....)))))).))))((.((((((((((((((.(((...........(((.((((((((.((..........)).)))).)))).)))((((....)))).......))).))))))..))))))))))))))..)))))))).)))))).)))))))))))))..)).)))...((((((((...)).))))))(((.((....))..))).(((((....(((.((((...)))).))).)))))..(((.((((((...(((((.......))))))))))))))(((((((.....(((((((((.((((.........(((....((((((..((..((((((((...((((((............((.((........))))...(((((....................)))))............................((((((...((((((.((......))))))))))))))...............((((..((.(((((.(((.((((......)))).))).))))).))..))))..))))))...))))))))..)).))))))...)))..)))).))).))....))))..)))))))............)))))))).)))))))))...(((.((...)).)))...........)))))))).))).......(((((....)))))))).))))).....))).......))))))...))....))).)))))))).))...)))..))))))).)))..)))))))).......))))))..)))))..)))))))....................
Thermodynamic Ensemble Prediction
.....{(((.,.((((.({{((((({..|}}}},.})})),.{(((((.........)))))}....,}}||||,,|}|,(((((....))))).,..(((((..((((((,{...((((((...(((((.((,....}).))))))))))).,,||.((({(({....,,)|}.}}}}(({(.....)))).,.....((((.......)))).|..((((.((((....((((((((((.......(,(..((.((((((((.(((...((..((((((.....(((,.(((((((,(((.((((((((.((((((((((((.(((((,{(.{,(((((((.....((((((((((((.,...,(((((((((((.....{(((((..((((.(((((((.(............,)))))))(((((.((((...((((((.{{..,((({,.,.}|||,,,...........,|{{|||..,}}}}}.{(((((((.........))))))))||)},)))))}.))))..)))))....(((..(((((.((....)).)))))..)))))))..))))))...,,{,,({{{.{((,.{{{{...,,,).,,.)))))).)))}{{.,(((({{((((,|{||{{{,(({{...,,..|||,|,||{....,})))))))..)))}|||((((((((({(({{{{(|....}},,,)))))).)))))))))})),,}))))..)))))))).))))))}}))))))))))))..}).}},...(((((({{...,}.))))))(((.((....))..))).(((((....(((.((((...)))).))).)))))..,{,{((((((...(((((.......))))))))))))}|(((((((.....{({{(((((.((((.......,.(((....((((((..((..((((((((...((((((......,,..,.{(,((........)),,...,..,,......,},...........|||,......,..,........|..........|||||,...(((((,,((......)))))))),,}}},....,,.........{(((,.((.(((((.(((.((((......)))).))).))))).)),,))},..))))))...))))))))..)).))))))...))).,)))).))).))....})))..))))))),...........)))))))).)))))))))...(((.{{...}}.))),|......,,.)))))))).))).......(((((....))))),)).))))).,...}}}.......)))))}...))....))).)))))))).))...)))..))))))).)))..)))))))).......))))))..)))))..,))))),....................

Transcripts

ID Sequence Length GC Content
NM_020056.5 ACAAUUGCUCUACAGCUCAGAGCAGCAACUGCUGAGGCUGCCUUGGGAA… 1458 nt 0.4698
Summary

HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. [provided by RefSeq, Jul 2008]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image