Basic Information

Symbol
HSPA1B
RNA Class
mRNA
Alias
heat shock protein family A (Hsp70) member 1B HSP70-2 heat shock 70kD protein 1B heat shock 70kDa protein 1B HSP70-1 HSP70-1B HSP70.1 HSP70.2 HSP72 HSPA1 HSX70 heat shock 70 kDa protein 1B HSP70-1/HSP70-2 HSP70.1/HSP70.2 Heat shock 70 kDa protein 1 Heat shock 70 kDa protein 1A heat shock 70 kDa protein 1/2 heat shock 70 kDa protein 1A/1B heat shock 70 kDa protein 2 heat shock protein family A member 1B Heat shock 70 kDa protein 1B Heat shock 70 kDa protein 2 Heat shock protein family A member 1B
Location (GRCh38)
6:31827738-31830254 UCSC Genome Browser

Secondary Structure

MANE Select
NM_005346.6
Sequence length
2517 nt
GC Content
0.5876

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-993.2 kcal/mol
Thermodynamic ensemble
Free Energy: -1035.7 kcal/mol
Frequency: 0.0000
Diversity: 560.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((((((.((((((((((((.(((((.((((((.....))).)))))))).)))))).....)))))).).((((((((.(((((((..(..((((.((((((((((.((.((((((((((....((.((((..((((.(((((.(((((.((((((((((((((((((.(((..(((.(.(((((((((((((((((((....))..(((....)))..((((((.((..((.(((((((((((.(((((......))))))))))))..........)))).))..)))))))).........(((..(((((((.(((((.....(((((((....(((...))).(((((((.((((((.((..((.......(((((.(((((.....(((.((((..(((((...)))))..((((((....))))))..)))).))).((.((((.((((((((....(((((....((((......((((((((.((.((..(....(((...(((.((((((.(((.....(((((((.........))).))))..((.((((((.(.((((((....))))...)).).)))))).))..))).)))))).)))....)))...)..)))).)))))))).....))))..))))).))))).))).)))).)).((((..((((((((((((((((((((.((.....)).)))).))))).....((((((.((((((..(((.((((((.((((((.....(..((((((((((.((((((...)))))).)))))).))))..)..)))).((.(((.((((((......))))..)).))).))......)))))))).)))..))))))(((...))).((((((((.(((.(((..........((((((((..(..(((.(((......(((....)))..))))))..)..)))))))).......(((((((((...)))))).)))..((....))..((((((....)).))))))).)))..)))))))).((((.((((((((((..((((.....))))..))))..)))...(((((.......))))).(((((.(((....(((((.((........)).)))))))).)))))((((.(((....))).))))...))).))))(((.(((.((((.........)))).))).)))..)))))))))))))))))....)))).(((((((......)).)))))......))))).))))).......))..)).)))))).)).))))))))).)))))).)).))))).))..))).((((((((..(((....))).....))).))))))))))).))).)).....))))))))))..))))))))))))))))).)))).).).)))..(((((((..((...(((..((((.((.(((.(((((.((....((.(((((((.((...(((((((..........)))))))........(((((.(..(..((....((((.(((((..((.........((((((((((((((((.(((.(.(((((.((((.((...)).)))).))))))))).)))))))).)).))))))..((((((...))))))))...))))).)))).))..)..).)))))(((..((((...........................))))))).......)).)))))))..)))).)))))..))))).)))).........)))...))..))).))))))))).))))..))))))..))))(((((.(((((((.((((((((...((.....))...)))))).)).))))))).))))).......((((((..(((..........((((.(((....))).))))))).)))))).)))))).))))))))....))))(((((...((((...........((.((((((((((((((((.(((............((((((.........(((.(((...(((((((((((....))).))))))))...))))))..((.((((((((...)))))))).))(((((((((..((........))....)))))))))......(((((((((..............)))))))))....))))))...........))).)))))))))))))))).))))))..))))).(((((((..((...(((((((....((..(((....(((((....)))))....))).))...))))))).)).))))))).....(((((((.(...(((((.........))))).....).))))))).))))..)..))))))).))))))))....................(((((((...)))))))........))))))).....(((((((..((((.....))))..))))))).....................
Thermodynamic Ensemble Prediction
...,,.(((((((,.((((((((((((.(((({{((((((.....)))}}))))))).)))))).....))))}}.|.((((((((.(((((((..(..((((,((((((((((.((.((((((,,,,{{..((.,(((.((((({,(((,.,((((.((((((((((((((((((((((..(((.(.(((((((,{{{((((({||.|||({.,({{....)))|,((((((.{{,.((.(((((((((((.(((((......))))))))))))},........}))).)),.))))))))........,(((..(((((((.(((((.....(((((((....(((...))).(((((((.((((((.((..((.......(((((.(((((.....(((.((((..(((((...)))))..((((((....))))))..)))).))).((.((((.((((((((....(((((....((((......((((((((.((.((..{....(((...(((.((((((.(((....{(((,(((.........))).))))..((.((((((.(.((((((....))))...)).).)))))).))..))).)))))).)))....)))...,..)))).))))))))..,..))))..))))).))))).))).)))).)).{(((..((((((((((((((((((((.((.....)).))))}})))).....((((((.((((((..(((.((((((.{(((((.....{..((((((((({.((((((...)))))).}))))).))))..),,}))).{{.{{(.((((((.,,,..}}}},,}),)}},)}.....,)))))))).)))..)))))|((,...))).((((((((.(((.(((..........((((((((..,,.((({{((......(((....))}..),)},)}}),.)))))))).......(((((((((...)))))).)))..,,,,,|||,.((((((....)).))))})),)))..)))))))),{{({.(((((,((((..((((.....))))..)))).,))}...(((((.......))))),(((((.{((,,,.{{{((,((......,,}).}))))}}),))))}((((,(({...,))).))))...}}}.))))|,{.{((.((((......,,.)))).)))})))},)))))))))))))))))....)))},((((({{....,.)).))))).,....))))).))))).......))..)).)))))).))}})))))))).)))))).)).))))).))..))).{{{{{,{{||(({,..,|||.....}}}|||}},}})))),))}})),....))))))))))..)))))))))))))))))}|))),|{|.,,|,,({(((((,.((..((((..((((.((.(((.(((((.((...,((.(((((((.((...,{(((((..........)))))||,{.,,,,.(((((.{..{..({....((((.(((((..{(.........{(((((((((((((((.(((.(.(((((.((((.((...)).)))).))))))))).)))))))).))},))))}..((((((...)))))),,...))))).)))).)}..}..}.)))))(((..((({.....|,,,.....,...........,))))})),..},..)).)))))))..)))).)))))..))))).))))..{{{{...,||...,,)).,)})).))))}}.))))},))))))..}}}}(((((.(((((((.((((((((...{|,,,.,}}.|.}}}})).}}.))))))).)))))..,.,|,|{{,||},|{|.,{{{.....||||}||{..}}),)})))),))}))))),.)))))).))))))))....)))}{{((({,.,{{{..{(((,....{(.((((((((((((((((.(((............((((((,{{,,.,{.{{|}||{,,,(((((((((((....)))}}))))))}..{|||{||{{,({{(((((((...)))))))}.||{((|,{{{||,||{,{{{{{{|,...}}}}}}}|||......{|||||{{|,,,}.},.,,},,})))}}))))...}))))))...........))).)))))))))))))))).)))))).,))))),{((((((..,{...(((((((..,,{,..{((.,..(((((....)))))....))).}}...))))))).,,.))))))}.....(((((((.{...(((((.........))))).....}.))))))).))))..)..))))))).))))))))....................(((((((...)))))))........)))))))...,,|.,{((({{(({{((((.,,.,.}))))}))))))}}}...,,,........

Transcripts

ID Sequence Length GC Content
NM_005346.6 AAACGGCCAGCCUGAGGAGCUGCUGCGAGGGUCCGCUUCGUCUUUCGAG… 2517 nt 0.5876
Summary

This intronless gene encodes a 70kDa heat shock protein which is a member of the heat shock protein 70 family. In conjuction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. It is also involved in the ubiquitin-proteasome pathway through interaction with the AU-rich element RNA-binding protein 1. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which encode similar proteins. [provided by RefSeq, Jul 2008]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image