Basic Information

Symbol
IGF2R
RNA Class
mRNA
Alias
insulin like growth factor 2 receptor CD222 MPRI MPR1 CIMPR M6P-R CI-M6PR CI-MPR MPR300 cation-independent mannose-6 phosphate receptor insulin-like growth factor 2 receptor M6P/IGF2R MPR 300 cation-independent mannose-6-phosphate receptor 300 kDa mannose 6-phosphate receptor CI Man-6-P receptor IGF-II receptor M6P/IGF2 receptor insulin-like growth factor II receptor Cation-independent mannose-6-phosphate receptor M6PR Insulin-like growth factor 2 receptor Insulin-like growth factor II receptor CD222 antigen
Location (GRCh38)
6:159969082-160113507 UCSC Genome Browser

Secondary Structure

MANE Select
NM_000876.4
Sequence length
14061 nt
GC Content
0.4943

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-4780.6 kcal/mol
Thermodynamic ensemble
Free Energy: -5037.46 kcal/mol
Frequency: 0.0000
Diversity: 4201.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.(((.(((((.(((((((((((..((((...))))..)).))))))..((((.((((((.(((((.((..((((..(((((.(((...........(((((((((((((.......(((((((...(((((((((.....)))).)...)))).))))))).))))))))).))))((((((.(((((.....)))))))).)))))))))))((((((.((.((((((.(((((.((((.((((...(((((((((((((((((((((((((((((((...((((.((...((((((((.((((.(((((..(((((....((.(((((((........................))))))).))......)))))...))))).)))).))))...((((((..(((......)))..))))))....((.((((........)))).))((((((((...((...((((..((((.......)))).......(((....))).((((....))))...))))...))))))))))..)))).))...)))).)))))))))....)))))))).............(((..((((.((.....)))))).)))....(((((....)))))))))).(((...(((......)))...)))...(((.(((((((..((((...(((((((..((((((((((........))))))..)))).))))))).))))))))))).)))(((((.((((((((((((((((...(((((((............)))))))........((((((...((((((((((.((((((...((((...(((((.((.(((((...((((((((........)))))))).....(((..((((((..(((......)))..))))))..)))((((((....)))))).......((((((((.((((..(.((((((((((...((((((((((((.((...)).))))))))))))...)))).(((((((..((((((...(((.......)))....((((((((...(((((((((.(((.(((..(((((.((.(((((..(((..((((...))).)..)))......)))))...(((((((....(((((((((.((((..(((((((((((((......((.(((.....))).))(((.....)))....(((((((((((.(((...))).))))))))))).)))))))))).(((((.....)))))............)))..)))).)))))))..)).....)))))))..)).))))).))).))).)))).......((((..........(((((...)))))((((((..(((((((.(.......).)))))))....((((.((((((((((..(((......)))...)))))))))))))).......(((((((((((.(((.....((((((..(((....(((((((((((.......(((.((((((.(((((((...((.....))))))))).)))))).)))..)))))))))))(((..((.((...))(((((((.(((.(..(((((...((((((.(.(((((......(((.(((...........))).)))))))).))))).))...)))).)..).))).))))))).......((((((.((((((..((((((((((((((((...(((((((((((.(((((.((((...(((((.(((((((....((((.((((((((((((((((.....)))))).((((((((((((((...(((...)))...)))))..))))..))).))....((((((..(((..............)))..))))))((((((.(((((((.(((((((((....((...((((.(((...)))..)))).((((((....))))))....((((((((((...((((..(((((((.(((((((((...))))).(.(((((((((((((........(((((((((((...(((((((((((...........))).))))))))....)))))....((((((((.(((((.((((((...))))))...((.(.(((((...((.((.((..(((((((..(((((((((((((..((((((....))))..((((.........))))))..)))))))))).((((((.(((...))).))))))(((((((((((((.((((.....((((((((((((((...............((((....((..(((...((((((((((........))))).))).))..(((((...(((((((((...)))))..))))...)))))..........((((.(((((.(((((((((((....((((.((...))))))...)))))).........((((((.(((((((.((......)))))))))..(((...(((....))).))).))))))...))))).)))))))))...)))..)).....))))..((((........))))......))))))).)))))))....))))(((((((((((((((((....))))).))))(((.(((((..(((......)))......))))))))..((.(((((((.........))))))).)).......))))))))(((((..(....)..)))))(((....)))...((((.(((((((.(.((((.............)))).).)))).)))....)))).)))).))))))))).))).)))))))..)).)))).))))).))))))))..)))))))))))))))))))))...)))))).)....)))).))))))))))).)))))))))).))..))))).)..))).)))))))..))))))...((((((.((((((((.............)))))))).........((.(((((.....))).)).)).)))))))))))))))).)))).))))))).))))).))))))))).))))).))))))(((.....(((((((.......)))))))...)))....(((.....))).....((((...((((.((((...((........))...))))...))))))))(((((..........))))).(((....))))))).....))))..(((..((.((((......(((((((.((.......))...))))))).....))))))..)))....))))))))...........))))))))))))))..))).......)))...))))))....))))))).))))))).....))))))))))...((((.(((...))).))))...............((((((((((....)).)))))))).....))))).))))).)))...)))))))))))))((((((....)))))).....))).))).)...))))))))))))....((((...))))))))).)).).))))(((.((.....)).)))))))..))))))))))))))))))))))...(((((((.(((....((((.((.(.(((.((((((((.(((.....((((..(((((..(.(((((((.......))).)))))..).))))..))))))))))))))).))).)..)).)).))...(((((((((((((((((((.......((((..(((((((..((((((..((..((.((((.((((.((((((((((((...(((((.(((.....)))..(((((((........)))).)))((.(((....))).)).((((.....))))(((((((((.((((...(((((.........(((((.((((....)))).)))))((((.((((..((((((((((.((((((......)))...(((((((...((((...))))...((((((((...))))..)))))))))))(((.(((....))).)))...)))))))))........))))....)))).)))).......))))))))).))))))))))))))...)))))))))))).)))).)))).))...))(((((............(((((((((((((((((((((((....)))))).))))).(((.((((.((((..((((.((...(((.....)))...))))))...)))).))))))).(((((..((((((((((.((...(((.((((....))))....)))...)).))))))))))...)))))...............))))).))))))))))))))))))...(((((......))))))))))))))))((((..(.((((((((((...(((..((((((........)).))))...)))...))).))))))).)..))))))))))))))))))....)))))))).))))))))))).....))).)))))....)))).))))).......((.(((.(((((.((((((((((..((((((((.(.((.....))).))).)))))..((((((((((((((.(((.((((.....))))...(((.(((..((.((((((((((((.((.(((((....))))).))...(((..(((((...))))))))...((((((((....(((((((((((((((((...((((....))))((((.(((((((((......(.((((((((.(((((((.(((....((((.((......))))))((((((.(..(((....((((.(((((((((..((((.......)))).......(((.(((((.........))))).)))..(((.(((.(.....).))))))......((((((.(((...((.((.((..((......))..)).))))..))))))))).........))))))))).))))..)))..)))))))............)))))))))).)))((.(((...))).)).(((((((((((......((((((.....))))))........)))).)))).))).((((((((.(((((..(((.........)))..)).)))))))))))..))))))......)))))))))..))))...........(((((((........((((((((..(((((((..(((((.((.((((..(((((...((((((((.(((((.(((((((((....(....)....))).....)))))).)))))((((.............))))........))))))))...))))).)))).......))))))).)))))))...((((((((.((....(((......))).)).)))))))).)))))))).(((((..((((........)))).)).))).....((.(((.....))).))....((((((((((((.((...)).))))))))))))......)))))))(((((((.(((((((((((((((..((((((..(((......(((((((((...))))).))))((((((((((((((.((....))))))))))......).))))))))..).)))))))))))))).(((((((....)))))))(((((.((((((..(((((((...(((.((((((((((.(((.......(((.....))).......)))...)))))))))).)))...(((.(.((((..((...........)).)))).).)))..)))))))))))))..(((............))).)))))...))))))))).))))((((((.(((((..((((((((((((((....(((((.....)).))).......(((((..((....))...))))).....))))).((....))..((((((((....))))))))....(((((((.(((((...)).))))))))))........(((((((.((.((((((((((..((.....))..))).))))(((.((((((.....)))))).)))..(((.....))))))))..)))))))))).))))))))))).))))))....))))))))..)))).).))))...)))).))))...((((((..((((...))))...))))))...((((....))))))))....((((((((((...((((.((((((.....(((......)))))))))(((((((((((.(((.((((.....((.((((((((((((((.....)))))))((((....((..(((((((((((((.........)))))).....)).)))))..)).....)))).((((.(((((.(((((((.........)))))))..........(((((((((......(((((.((....)).))))).(((((((.(((....)))...))))))).((((((.((....)))))))).((((((...(((......((((((((((((((.............(((......))))))))))).).))))).))))))))).........(((..(((.(((((((((((..........((((((((.((.....))..))))))))............(.(((((..(........)..))))).).)))))))))))..)))..)))..................((((.(((((.(.((....)).).)))))))))....))))))))).(((((..((((...))))..)))))))))).))))......))))))))))))))))..))))))).)))).......((((....))))((((((((((.(((((.........))))).......((((.(((((.((((((....(((.....))).....)))))))))))))))((....))......((((.(......).)))).))))))))))(((.(((.((((.....))))))).)))....))))....)))))))))))))))))).))....))).))).(((((((((.....((((((.......))))))((((((.(.((....)).).)))))).........((((((((..(((((..(((((((((((((...(((((.(.(((((((.((((.....)))).(((((((((((.(....))))..)))..)))))......((........))...(((((((((((.((((.(((((((((((.((((((((..((((((............))))))..))))))...(((((....))))))).))).)))))))))))).((.(((.(((((((.(((.......)))......((((((....)).))))..........))))))))))..))(((((((((((((((.(...(((((((((....(((((...)))))(((..(((((.(((.....((((..(((.......)))..)))).....)))...)))))...)))..((((((((...)))).)))).....((((..((.((....))..))..))))..........))))))).))...)..)))))......)))))))))).((((((((((((......).)))))))))))...((((((((((((...((.(((((((((....(((....((((((....))))))..)))....))).(((((......)))))..((((((.((((((....)))))).))))))..............(((((((((((.((((.(((.(((........))).))).)))).......))))).))))))...(((....)))...))))))))...................))))))))))))..))))))))))).........((((....))))................)))))))))))))((((.((...((((((..(((((.(((((((((..(((((((.....(.(((((((((.........))))))))))..))))))).))))))))))))))......)))))).)).)))))))).))))))))))))))..))))))))))))))))).(((((.((((((((((((((((.((((((((((((((((((((((..((...))..))((((((((((.(((((..(((((.(((((..((.....))..))))))))((((......)))).))..))))))))))))))))))).((((((((..((((..(((((((..(((.(((...........))).))))))))))))))..)))))))))))))))))))))))).))))))))))))))))(((((((....((((((((((((..(((.........(((..(((((......)))))..))))))..))))).)))))))..)))))))...((((......)))).....((.(((((........))))))).......))))).....))).)).)))).)))))))).......((((....))))(((((........)))))........))))))).))).))))).)))))))).))))))...))))))))))))).))))))))...))))))..)))).)).)))))..)))))).))))))).)))))..(((((((((((((((((((((((...............))))))))))))..((((.((((...(.(((......))).))))).))))..........(((((((((((((......(((.....(((((((...((((((........).))))).))))))).(((((((((((.((((..(((((.((((((((((.....(((((((.(((.((((((((((((.......((((((........))))))......(((((..(((((........))))))))))(((...)))......((((((((((.((((......((.(((.((.........)).))).)).....)))).)))))))).))((((..((((......(((((((((.....((((.(((.....).)))))).....)).......)))))))..(((((....(((((......(((((((......(((.......)))........)))))))......)))))...)))))))))..))))(((((((((.(((((((.......)))))))((((........))))(((.((((....((((((((((((....(((((((((.(((((((((.....)))))((((....))))((((((...............)))))).....((((((((((.(((((......))))).)))).)).))))........(((((((.(((((((((...((((.(((....(((((..((..((((((..(((.........)))....((((.................(((((((...((((..................))))...))))))).((((....)))).))))......((((...................)))).....((((.(((((((((((((((((((.((((((((((......(((((((((((((.(((((.(((...((((.(((((((((.((((....))))))))....((((....))))...))))).)))).))).))).)).....(.(((.(((.((((((((((.(((((((((....((((.(((((.((((((.((..(((((((...(((......)))...)))))))..))..((((.(((((...((((((((((.((((..(((.((......(((((((((.((((...............))))..)))))))))......)).)))))))))))))))))...((((((((....)))))).))...))))).))))((((..(((((......(((((.(((((((.((((((....((((..((.....))..)))).....))))))..))))))).)))))))))).))))...)))))).....(((..(((((......)))))..))).(((((((.........)))))))...(((((......)))))..................(((.......(((.(((((.....)))))))).......))).)))))..)))).......(((.(((...((((((((((((((((((.....(((((((.((((..(((((..((((((.(((...((((.(((((((((.......))))................))))).(((((((((......(((((...(((((((..((.((..(((((..((((......))))..)))))..))))..)))(((..((((......))))..))))))))))))....))))))))).)).))...))).))))))..))))).(((....)))....((........))......)))).)))))))((.(((....))))).............(((.......)))..(((.(((((((((((....).)))).)).))))))))))))).....))))))))))))..))).)))..)))))))))))))))))))..))).))).).(((.(.(((......))).).))).....))))....)))))))))(((((.((((..(((.(((((((((.(((((....((.(((.((((((((((((((((((((.............(((((....((((((...))))))...)))))((((((((........((((((((((....((((((((((((((((.(((((..(((.((........(((((((((((((.(((((....(((.((.(((((((....)).))))))).))).((((((((((....(((((((((..(((.........)))...)))))))))......................................................................((((........)))).)))))))))).........((((.(((((((((((((.((....)))).)))))))..))))))))(((........))).))))).)))).)))))))))...((((((((......((((.....))))...))))))))...................(((((.(((...))).)))))))..)))..))))).)))..((((((......((((((((((((((...))))..(.((((((......(((....)))......))))))).(((((.((((((...)))))).)))))...)))))).)).))..))))))...........)))))).))))))))))))))))).......))))))))((((((((..(.(((........))).).....))))))))..((((.((((((.....))))))..((((.((((.(((((((((((((((((((((.((((((((..(((((((((........))).((((((((((((((((.((((((.(((.(((((((.((........)))))))))..)))(((((((((.((((........))))..)))))).)))...)))))).)).))))..((((........))))....(((((((......)))))))))))))))))......(((((((....((..((((((.((((.......(((((((((...))).....)))))).....)))).))))))..)).....)))))))))))))...)))...)))))((((......(((....))).......)))).....((((.((((((((((.(((.((....(((((...))))).)).)))...)).......)))))))).))))...)))).))))))).....)))))..))))).)))).)))).))))))))))))))))))....))))))..)))..)).......))))).)))))))))((((((......))))))...)))))))(((((((.......))))))).......))))))))))....))))))))))))))))...((((((.......))).)))....)))).)))))))))))))).))..)))))..(((((....)))))...(((((((((((((..((((.((....(((((..((((((.((((((....)))))).((((....))))....)))))).)).)))...)).)))).)))))............))))))))......))).))))..)))).))))).)))))))(((((.((((.............)))).)))))..)))).)))....)))).))...))))))))))))..)))))))..(((....)))..........(((((.(((.((((((((.(.(((((((...........))).)))).)..))))))))..))).)))))...(((((((((((((((...))))((((((((.(((.(((((........))))).))))))))))).......))))))))))).......))))))))).(((((((.((((((.((.......(((((........)))))..)).)))))).)))))))(((.((((((............(((((.......))))).(((((((.((((((((.((((........))))((((((((..((.....(....).....))..)))))))).((((...))))................)))))))).)))....))))..(((((((....................))))))).(((....))))))))).)))))))))))))))((((((.........((((..(((..(((((((((..(((..(((((......))).)))))))))))).....))..))).))))))))))......))).))))))))))))))))).))))).....(((.....))).....(((.((.(((((((.(((((....))).)).)))))))..)).)))...((((((.......))).))))))).)))))))))))...))).......))))))))).).)))(((......)))((.(((((.....))))).))......((.((((((...(((((((.......((((.(((((((.(((.(((.(.(((.((.((.(((.(((((((..((((((..((((...))))..))))...(((....))).((((((((((((((.....(((.(((((((.((.............)).))))))))))..((((((..((.(((((((........)))........)))).)).))))))......((((.....)))).((((.....))))..(((........)))...))))))))))))))................(((((.........((((((....)).))))))))).((((...(((((..........))))).)))).....))..)))....)))).))).)).)).))).)))).))).))))))))))).......)))).)))..)))))).)))))))))))))...((((.....))))..(((.((((...((((...((((((.((.............(((((((.....)))))))...)).))))))...))))....)))).)))(((((.(((((((....)))))))...))))).....))).))....
Thermodynamic Ensemble Prediction
.{(((((((((((({((.((((((((..((((...))))..)).))))))..||...,,{,.,,((((.(((((((((,{(((((.(((...,||,..}}(((((((((((((......,{((((((...(((({((((.....)))).,...)))).))))))).)))))))))},)))((((((.(((((.....)))))))).)))}}||}|||,{(,((((((((((.(({(((((((((.{{(.(((((((((((((((..(((((((((((((((((...((((.{{...(({{((((.((((.(((((..(((((....((.(((((((.......,........,}}.....))))))).))......)))))...))))).)))).))))...{{{(((,,(((,....,|||,.}|||}|,|.{((.((((.,......)))).))}{{{{|{|.,|||,..||||,.((((.......)))).......{,,....|||,{{((,,.,|}}}..,)))),..))))}))))}..)))),)),,.)))).)))))))))....))))))))...((((..,,.(((({{(((,,{{....,}|||||{{{{,,,,(((((,,,,|}}||{{{{,.|||,..,,,......}}}...}}}..|{{(,{(((((({,,{{{...(((((((.,((((((((((........))))))..)))).))))))).}}))))))))}.))}|||(({{...{{{{,,})}||,.{{{{{{||,,,.{{.{(((((....)))))).)}.....||,|,||{.{{{|,,,...,.,||||((((((((...{(((...|||},,{(((((((........)))))))).....{({..((((((..(((......)))..)))))),,))),))))))))}))))))}})))}))},,)))),,.((((((...(({{(((...((((((((((((.((...)).))))))))))))...)))|||((,({...,},,.||,.|||},{{,{{|,}...,||{,(({..,,,,,..{{...}}}.,},....}))))),,,.}},)))...)))))).((((((.,{,......,|,....},,,.))))))))))))))))))))).}.,|((((((((((......((.(((.....))).))(((.....)))....(((((((((((.{{,...,)).))))))))))).))))))))))|(((((.....|||||.(((........)))))))))))))},.....(((...{(((......))))....))}..))))))))).(({......}))...{({(((((...))))).)).....(((((((.(.......).))))))).,..((({,((((((((((..(((......))}...))))))))))))))......(((,,(({....,{((({.......})))||..,{.(((((((((((.......(((.((((((.(((((((...((.....))))))))).)))))).)))..))))))))))),}|}}}.})),.}))(({({((.(({.{..{(((({{{{,((((.(.((((({{{{..(((,,,,....,}}}...,))})},))))).))))).))},.,))).}..|.})).)))))))........,,},)}.)))))))))).))..)))}})))..}|||{{((((,,.|||||}||||}}},,,||}||||,,,....,((({(((((,{{{{{{{{{,..,,,))))),.{{({{(({((((((...((,...}))...)))))}.,}}}.,|}|{|{({,({{(((({,(((,..,...,,,,....}}.,,}},||(((({{,({{{{((,(({{{{(({,...|{.||{{(({{{{{,{,,|,{{{{|{((,{(({{{{}|||||....((({,(((((((((((((....)||)))))))||{|,.,)))||,{{((({{{,{{({{{{((({{,{{(({{{(((((,,.(((((({{(({........,,.|||,|}|||||}..,,||}}|,,,,{{{{|||{|..,,,,||.||})}})}}},...{((,(((((((,{(((((,(((,,(({,{,,{,,((((((((((((..((((((....))))..((((.........))))))..)))))))))).}|..,|.,...(((((({.|||{{,,(((.((.,((..(({.....}}}}},.)).,}}}))}}},,..})))))),}}.|||||}.},|||}|||,|}||||||||||,|||||,.}}|,|{{,({{((,{{(((((((((...))))).,||||...||}||,||,....||||||||||{,.,,{{{{,.,{|,{|||,(({(({{(((({({.,{((,((((({{{{{{{((({(,(((((((({((......,||||||}..((((.....,({{{,(({{{({{{{{|...{||{{{.,||||{|(({,..{{,{{{||,,,||||{|||||||,....,||.||,,.,,||||,|{((|,,|||..,,))),||||{{(((((((((((....))))).)))}{{{,{{{{{,,{{{.....,||||||,,|||||{(||..|||(({((((..,,.....)))))}},|||.|{{,,|||||||{{{{,,.{({{{{|{{({{{{(((,,.,|||...,(((.{((((((.{,((((....,..,.|.,,))}),|.}}}),)}).},},|{(({|.....})))))|{{.{{||,(((.{(((({,.{|}}|{||||{.......,,.....)))),))).})),)))))))))).)}}}.,}}}}))))))))}||{|||,,|||||,..,,}|}},.,.,|||,|||||}|..|}}}}}||.,{||,,.((((((((.{.,......,..)))))))).....,,,,{{..||{{....,})),}}{||,||||}}||||}}}}}}.,}}},}))))},.|}})}.))))})))),}))))|||||||(({.....{{((((({,{{,,{|||||||...|||{,,{(,.,{{{((({,,...{{((,(((,,{.,{{{{.{({{{{..||,,...,|||},,.}}}},}}.|||,|}}}}},.,}.,))))|||{,,..,|||||{,|||,||||..||||.||{|||||{|||||{||{{{.||,,,,,,,))...}}}||||,,,,,|(((({,,|,,,..{{{||||{.,{,|{|..,,...}})}}))}})))}},,}}...||{{,...})))),,....|,||||||}|{{|,|||||||.{{{{{,||,{,{{{{.|((...}}}.})))||},..,|,|,....((((((((((....)).))))))))...{{||,,,,|,{{(((((({....})))))}||{{{,.,||||,({(((,,..,|||.||||{...,|||}||||{,....,{{{||}.,))))){||,|||{,|,||||||,|{|,}.{|{|.,,,)))).,))).))|}))).).}|}}.}}}...{((((((,,{{((((((((.....(((.((((((((.(((...,,(({{.,((((,,,({(((({{,,,..,},))},)))))..}.)))),,}))}))))))))))).))),,{(((({,({({{(({.......)))}}})})))))}.,.{(({..(((((((..{{{{{{.,({,|({.((((.((((.((((((((((((...(((((.(((.....)))..(((((((.{,...,})))).))}((.(((....))).)).((((.....))))(((((((((.{({,...{{{{{.......,.(((((.((((....)))),)))))((((.((((..{{(((((((({(({{{({(({.{{||...((((({,...((((...))))..|{{{{{{{(...}})}.|}}))))))))){,{,|{|||,.))}.,,....}))))))))........,}}}...,)))).)))).,,,,,,}}}))))}).))))))))))))))...)))))))))))).)))).)))).,,...))(((({,..........|{((((((((((({((((((((((....)))))).))))|.(({.((((.((((..{{{{.{{..{(({.,...},},}.)))})),||}}}).))))}||{({{{(.,((((((((((.((...(((.((((....))))....))).,.)).))))))))))...}))))......,,,......))))).))))))))))))}}))))}}}((({{.....,)))))))))))))))}))))),...,,||||||{||}||,..{{{,,.......,||||||||||||||,}||||||||||}}|||..{(({,.,{||||||,|,...||}||,||||(((....)))|.{,,{({,.{{{({....,,,.....},,))))),|||||||||||,,,.}}|..}},..||||||||}|}|,}}}}.,,..)))})))}||.({((((((.,,{{,,.,{((((({,...||||,.{((({{{.{.{{{,{{{{...,,{{,{{.{{{{{,,,,|||||.,,...,,,..(((((...))))),)),}}}}.)))}.},,.)}))),)))}||||||}}}}||||}}}.))))}.}.}|||||||||,,||,,|.}},}}}}.||||((........}},|||{(({{{.{{||||||(((({{{(..(((....((((.(((((((((..{(({.{{{.(((({{((.((((((((,,(((({({.,.,..{{{.|,{{{{((,..,,...})}))),}}.)),.....)))))}.,|}}}..,.}|}}..}))})))}.))},}.{||||{.,,,)))))).........))))))))).))))..)))..)))))))...{{{{{{||{{{|||||||.{||,...))}|{||({,,{|{{|{{{(({,{{,...{((((,,..}}})))},,||},..,,}}},.,..(((((((...(({(.,{((({(((((((..{((.(..((((((((((((.(((.,,.............,,..))).)}}})).))))}.}}..}.)))))))))}..((((((((..(((((((..(((((.((.((((..(((((...((((((((.(((((.(((((({((,...,....,....))).....)))))).))))){{{(,,,,.........))}),,......))))))))...))))).))))..}}...)}))))).)))))))...((((((((.((....(,,.....,,)}.)).)))))))).)))))))).((({{..((((........)))).)).)))....,)))}..)))})))))))....((((((((((((.((...)).)))))))))))).,....{{{{||{{({{{({,(((((((((((((((..((((((..(((,.....(((((((((...))))).))))(((((,((((((((.({....})))))))))......}.))))))))..),}))))))))))))).|{{{|||,..,)))))))||||,}||||{(,,(((((((..|||{,|(((((((((.(((..,,...(((.....)))....},.)))...))))))))},.,}|,,,(,,...,{||}||,|,,|,|,|}..},.,}}|,}.})}},)))}|||||||||((((.,,.......,,.)))))))}}.,,}}))}}}}},)))),,,,||{||||||.||||((((({{{(.{{{{((({(({(,.,{,|||,{{{{.,(|(.{|{((..{{||||.|||{{{{{..,,{{{.,.({(((({{((((((((....))))))}}....(((((((.{(((,...)),,}}))))))).....,,}|,|||||}|..,|||,{,|||}}||},,.,{|....)})}))(((.((((((.....)))))).)))..,((,,...},,.,,....,,}}}))},))))))..))))},)}}}}}},||||}}}}}||}|,.,.}|||...,,{||{{{{,||,,,{{{{,..{{{|,,,})))...,}}},,.,||||{|{{{|(.{((,(({|.|||||{{(({{{{.},|,||,,|||...||||}|||,|}}}},|,|}|},.,,,....{{{{.{{|...))),)))),.{{.(((((((.....))))))).)},,{...,({(({{{|(((((((,,.......}))))}}.,,,{{{{,(((({..({{{((,(((,(((((((({{(((((((.,......,))))))).,,,,,.((((((.{........,.))))))((((((,{(((,,..(((((((.(((....)))...))))))).((((((((((((((({,,,..{((({.....((((..{(({..,(((....(((({....})))}..))))}}}.(((.(((((((((,{{((((..((((((((((,,(({..(((..(((.(((((((((((..........((((((((.((.....))..))))))))............(,(((((..{........}..))))).}.)))))))))))..)))..))).,.....(((((......((((.(((((.(.((....)).).)))))))))......)))))(({({(((..((((...))))..)))))))...,{({((((((((((.{,...,}}))))))))).,)||..(((((((((((((((..(((,((((((((((.(((((.........))))).,,{,.{(({(.(((((,((((((....(((.....))).....)))))))))))))))||.,,.},....}|((((.(......),)))).))))))))))|{.(((((..((((((({(.(((((({......,))}))).||(({((((.{(.((((.......|}|}|}.}}}}...||||....||||{|}},.,},)}}}}{((((((.{.((....)).}.))))))}........{(((((({..((({((((((((((((((((...(((((.{.(((((((,(((,.,...|||,.(((((((((((.{....))),.,))}.,)))}),,...}.,}},,....,|..,(((((((((((.((((.(((((((((((.,,((((((..((((((..{.........))))))..)))))).,.(((((....)))))),.)))))))))))))))).,,.(((.(((((((.(({....,}{|,,...,,..{||{(,,{,},.}}}),,,,......)))))))))),,||(((({{{((((((((.(...(((((((((..,{(((((...}||||.{...{{(((.(((.,...((((.,(((.......))),.))))...,.))).,,)}}}}...}}}|.{{{{{({(...}})).},)),)},.((((..((.((....))..))..))))..........))))))).))...}..}})))},....)))))))}},.((((((((((((......)}}))))))))))...(((((((((((({{{((,({{{{,{{{...,||||||.((((((....))))))..|||.,,{|||,{((((......))))}..((((((.((((((....)))))).))))))...{{,,...,,,.,{{{{{||||{.{|||,(({{(((......)}))}.))).}}}}.......})))).))))))}.,||{....|||,..,}}))))}...................))))))))))))..))))))))))),}.......((((....))))................)))))))}))))),{((.{(,..((((((..(((((.(((((((((..(((((((...,.(.(((((((((.........)))))))))).,))))))).))))))))))))))......)))))).)).)))})))),})))))))))))})}})))))))),.(((((({{{(|,(((((((,,((((,.(({.((((((((((((((((({(((((((....))...{((((((((((((((((..(((((.(((((..({.....)}.,))))))))((((......)))).))..)))))))))))))))}{((({(((((((..(((({.,{(((((..(((.(((...........))).))))))))))))))..))))))))}))))))))))))))))))))))))),)))|{(((((.(((.((((((((((((((..(((,........(((..((((,......)))))..))))))..))))).))),..)))))).))).)))))}|{((({...,}))},{{.(((((........))))))).((((....))))...,)))).))))))).)))},}}}})),,(((((....)))))})}}},((((((..(((((((((.((.....))...))))))).)))))))).)))))))..))))){{(((((((((.(((,{(((((((,{{.(.(((.(((..((((((.((.(((((((((({(((((({{{({,,..((((((((((((.{{..........}.)))))))))))))))).))))))}..))),.,{.({((((,,(((..(((((((.................)))))))))).))))))}}.})))))).)}.,).))))))..))).)))}.}}.(((.(((((((((((....,,...,|{{{,,,,,....{{{{,(((.........}}}.,},,.....,,,,,{{{{((........}}})))......{{{{{..{{{{{........))))}})))),((.((((.(((........))).)))).)).....))))))))))).))),)))))))))),))))))))))),)))..))))))))))))))).........))))))))))))))..)))}.|||((,.....,}},}},...))))))))).)))((((....(((((......(((((((.,,...(((.......)))...,,...)))))))......)))))...)))))))).....))))))))))))))))))))).......,,,.{{((({..{{{.|}...,{||||{.,..{{{.,,,|,||||||||..,{|.,,,,.}},||||({{,..|||||((({..,,|||,,,||||,,,,||||||.....,|||||.{{..{{{((({(((.(((((......))))).)))}.}},}}}}}}},,,,},||||||.,|,||||||...,|||}..|}}}}|,,,,......,,||||..||}}}}.....,)}}.,}}}}}}.................(((((((...((((..................))))...))))))).((((....))))..,,,.}}}}}))))}))}}...,,|,,....,,)))}......}}})}}})|}}||||||||,,,,.||||||||||}...,,||{{((((({{{{,,{(((.(((...((((.(((((((((.((((....))))))))....((((....))))...))))).)))).))).))),)),....,,|||.|||}||||||||||.|||||||||}}..{{||.|||||,}{||||,}||}||{(((....|||....}})))}},}|||||,,.{{{{({({.,{{{{...(((((((((((((((..({{.{(......(((((((((.((((...(({,...,)}}.))))..)))))))))......,,.})}))))))))))))))...,,{((({{{{,.||||||.|,...||||}.}||,|{{{|{.,|,,.....{(((({.(((((((.((((((....((((..((.....))..)))).....))))))..))))))).})))))))},.}))),,.)))))}.}},,}}}..(((((......)))))......(((((({.,,....,.)))))))....||||}.}}}}))))}))}})))).........{((...,}}..(((.(((((.....)))))))).......,}|,||}||,.||,,.......{{{.,{{,..{{{,(((((,((((....}}}}.||||||,.,{,,..{{(({..((((((.({(,{{((((.(((((((((.......)))}...............,))))).(((((((((......(((({...(((((((..(({({..(((((..((((......))))..)))))..))})..})}(((|.{(((......))))..}))))))))))),}..))))))))).))},).}}))).))))))..})))).|||....|||,,.,{{{{,,,,|,,|,,,,,,,|||{||||||||||.{||,,.}||||||{{{{{{,.,,,,(({{{{{.,|||{{{{{.{((({{{((({....).)))).}}}}}}})))))}.,})))..}})}}}}))))),.}}}|))},.}})))}}))))}})))))}||}}|{|||.|,{,,.|}{||},,...))),}..,},,.},)))),,..,}})))|||((({{.{(({.{((,.(((((((((.((((({,({((,(((.(((((((((((({{(((({{..,||,,,,,...(((((....((((({...})))))...))))){||||{{(,{....,.((((((((((....({((((({((((((((,(((({,,{{{.||........(((((((((((({.(((((,...(((.((.(((((((....))}})))))).))).{{{{||||{|,...(((((((((..(((.........)))...))))))))).................,,.,,,............................,,...,,,,........,,{{{{........)))).)))))))))),}....}}}{(((.((({(((((((((.{(....)})).)))))))..)))})))}{||,,,,.,..))),,})))})))).)))))))))...((((((((......((((.....))))...)))))))).....,,,...........(((((.(((...))).))))))),.}))..))))).)))}}((((((,{{{..,,{{((((((((((...))),..,.((((((...,,.(((....)))...,,.))))))|.{((((.((((({...)))))).))))),.,)))))).})})}..))))))......,,,...,}}))},}))))})))))))))).,,..,.}|||||||{((((({|||||.,,........|}},,,,|,.})))))))..{(((.((((((.....))))))..{(((.((({.{{{{{{{{{((((((((((((,((({({((,,{,{{{{{{{..,,....))),((((((((({{(((({.((((((.(((.((((((({,(........)))))))))..)))((({(((((.((((........))))..)))))).)))...)))))).)).))))..((((........))))....(((((((......))))))))))))))))),,.,,.{((((((....{{..((((((.((((.......{((({{,{,...,}}.,...})))}}.,,..}))}.})))))..}}.....))))))}}}}}}},,,}}}..,}})))||||.,,...,|,,.,,|}}.,,}}}}}}}|,|,,,{(((.((({{((({{,,,,.,{....(((({...})))).||,|||,,|},..,,...)))))))),)))),,.))))}})))))),,,,.}}}})},})))}.)))).)))),)))))))))))))))))}.,..))))))..))),,}}..,.,,,))))}.))))))))){{{{{{...,.,))})))|..}}}}}}|{({{{{|....,.})))))),.,,}||,|||||}||||,...,})))})))))},}},..,||||||}}|||||)))|)))}}.,))))})}}}}}}|))}}}},,,.,)))))}}||{|{|||,}}}}....(((((({((((((,{({{(,{{....{{{{|,,||{{||}|||||{..,.,|||||,({{{||..,},,,,{{|||}||.,}.))},,,)},))))})))))..,...,,,,..))))))))......,,,.})),,,))))})))}}..))))))|}||,.||||..,|,,.{{,...||||{||{{{{,,,..{{{{{|,..,||,|||||,.||||}}}},||{|{,,,,|,.(((....)))..........(((((.(((.((((((((.(.(((((((...........)))}}))).)..))))))))..))).)))))}}}|.(((((({,.((((...)))){(((((((.(((.(((((........))))).))))))))))}...,.)))))))(((((((.....))))))).,{.(((((((.((((((.((.......(((((........)))))..)).)))))).)))))))||,.,{{|||.,,,........||{{{....,,,))))),{{{||||,|{{|||,,.((((........)))),,,{{{({||{{|,||,.,.|||,....||..,},}}}||{((((,,,}}}},||.,......{{{{.}}))))},.}}}....||||,.{{(({((....................)))))}},|{,..,,||}||||}|,}}}............||||||},}}}..,}|||,|}|||.,{{(((((({,.{((,.{{,{{......,}}.))))}))))))).....})}})})|||}},))))}..,,.,}}})))}}},,,,..}|}}}|{{.{(({|.,,{||.....)))|.,},),..,{{|||{{{|,||{{{...,))|,||{||||}))}.,}}))))))},}}||}}},,}.,||,|}|,|||}..,,.,}}}}}}},},...........,}}}}}}}.|}}|||,.....||||||||...|||||||||,,,,,,..|,{(,((((((...(((((((.......(((({(((((((.(((.(((.(.(((.({.((.({({(((,(({(({(((((..((((...))))..)))}}}}|((....}}}.((((((((((((((.....(((.(((((((.((.,...........)).)))))))}}}.,((((((..((.(((({{(,,,,,...}}}...,,,,,)))).)).)))))),.....|{{(|||..}}})}||,,..,,,||}}..,{|,.,}}))}.,,...))))))))))))))......|,........{{{{{.,,......{{{{||....,},))))||||}.{{{{..,({(((..........}}}}),)))}...)))},,,},.,,.)))))))).,).)).))).)))).))).))))))))))).......))))},))..)))))).)),}}|}||,|}}|}}||||..,,,)))),.}),..)))},),.}))}}}|,.||.||}}}}},,,},...{((((((.....))))))),,,}..}},,))},,}}.,,,........|((((((,({{{{{{.,,,)))))}}...,))})},,},})),)}....

Transcripts

ID Sequence Length GC Content
NM_000876.4 GCCGCUGUCGCUGUCGCCGAGCCCAGUCGAGCCGCGCUCACCUCGGGCU… 14061 nt 0.4943
Summary

This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image