| ID | Sequence | Length | GC Content |
|---|---|---|---|
| NM_000576.3 | ACCAAACCUCUUCGAGGCACAAGGCACAACAGGCUGCUCUGGGAUUCUC… | 1507 nt | 0.4618 |
The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. The induction of cyclooxygenase-2 (PTGS2/COX2) by this cytokine in the central nervous system (CNS) is found to contribute to inflammatory pain hypersensitivity. Similarly, IL-1B has been implicated in human osteoarthritis pathogenesis. Patients with severe Coronavirus Disease 2019 (COVID-19) present elevated levels of pro-inflammatory cytokines such as IL-1B in bronchial alveolar lavage fluid samples. The lung damage induced by the Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is to a large extent, a result of the inflammatory response promoted by cytokines such as IL-1B. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, Jul 2020]
No forensic context available.