Basic Information

Symbol
IL1B
RNA Class
mRNA
Alias
interleukin 1 beta IL1F2 IL-1B IL1-BETA IL-1 IL1beta interleukin-1 beta IL-1 beta catabolin interleukin 1beta preinterleukin 1 beta pro-interleukin-1-beta Interleukin-1 beta Catabolin
Location (GRCh38)
2:112829751-112836816 UCSC Genome Browser

Secondary Structure

MANE Select
NM_000576.3
Sequence length
1507 nt
GC Content
0.4618

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-428.3 kcal/mol
Thermodynamic ensemble
Free Energy: -458.38 kcal/mol
Frequency: 0.0000
Diversity: 454.2
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.....((((((((.(((((........(((((....(((...)))..))))).((((((((((((((.(((((((...((....)).))))..))).)))))..((((.((.(((((....))))).)).)))))))))))))..))))).))))))))....))).......(((.((((((((((......(((((((.((.(((((((((((((((....)))))......((((....(((((.......(((((((((((.(((..(((((((........)))))))..(((..((.(((((.((...(((((((.(((((......(((((((((((.(((...(.(((...(((((...(((((....)))))))))).(((((((((((......((((((.....((((((((((((...))))).........((((.....((((((..(.(((((((((((......)))..)))).)))).)................(((.((...((((..(.(((((((((((((.((((.....))))))))))))))..))).)..))))..)).)))..............((.((((...)))).))((((..((.........)).))))))))))....)).)))))))))((((((........))))))...)))))).............)))))))))))........((((((((....))))))))............))).)...(((((..(((((((((....)))))).......)))...)))))(((.......))).))).))))))))))).......)))))..(((((((((.((.(........)))..))))))))).....(((((((((.((.......((((((.(((((...(((((.....(((((((((.(((((...((((((((.(((((((........(((....))).))))))).))))).............)))..))))).)))))))))..........(((....))))))))))))))))))).)))))))))))......(((((.........)))))......)))))))..)).))))).)).)))......))).))))))((.((((((((((((.(....)...)))))...........)))))))...))..............((((....))))..........................)))))........)))))......))))..))))))).))).))..))).))))......)))).(((((......))))).(((((((.......((((((((((((((((....(((((....((((((((.(((..((((............)))).))).))))).)))...))))).....)))))..)))))....))))))))))))).......)))))))))............
Thermodynamic Ensemble Prediction
........{(((((((({.{,,(((.({{{{(((((....(((({..,,.{|{{||.((((((((((((((.{(({(({,.,{{,,,,||{|,|},{|}}.}}})),.|||{.{{.{{{{{..,,))})).)).)))))))))))))..,,}}}.},}}}}})}}},|||{{((...{{(.{({{({{{(({{,..||||(((({{({({((({{{{((({(({,{{}}}||||,...|.....,}|.|||,,,....,|||,|||{||}|||,,(((((((........))))))).,|||..||||{((({(({{{((((({{,((({{...,,.({{{{(((({{..,{,|,,,|||,.,|||{({{,((((,,,,,|||||||||..,,,||||||||,.....((((((.....((((({{(((((...}))))..,,....,({{(...,.((((((..{{(((((((((((......)))..)))).}}}}||,.,....,..,,,...|{{,{{,..((((..(.{((((((((((((.((((.....))))))))))))))}.,)}.)..))))..},.,||,..,{.......{{((.((((...)))).)}|||....,..,,..,,},}})))))))))).,..)).))))))))){(((((.{....,.})))))...))))))..........,.,))}))))}})),.....((((((((((....))))))}},}))........}|||}...{((((..(((((((((....)))))).......)))...)))))|{{.......))),})))))))))))))),.,....))}}},||{|{,,,,,.||.|.....,..}},..}}))))))},,,..(((((((((.,,....,..((((((.(((((...(((((.....(((((((((.(((((...((((((((.(((((({........(((....))),})))))).))))).,,,.........)))..))))).)))))))))..........(((....))))))))))))))))))).}))))))))))......|||||}}}}}}}}}))),,..})))).))).,)))))......,..,.,......,,,..,||||{{.((((((({{(({.{........)))))...........)))))))...||{{.,,.....,}..||||....|,||.,{.{{,{{..,{......,|,||||,||||,,,.....|||||,.,,,.,,,.,{||||||||.,,.}|,.|||,,|||,....,}},|{(((((......))))).||,,{{{.......||||||||{|||||||,,}}|,|||....{{{{{{{|.|||},||||.,,,,.,,,,},}})),})).,)))),)))}..,,,,,....,|||||..,,,,,...})))))}}))))}|{{,....,,)))),,)}))}........

Transcripts

ID Sequence Length GC Content
NM_000576.3 ACCAAACCUCUUCGAGGCACAAGGCACAACAGGCUGCUCUGGGAUUCUC… 1507 nt 0.4618
Summary

The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. The induction of cyclooxygenase-2 (PTGS2/COX2) by this cytokine in the central nervous system (CNS) is found to contribute to inflammatory pain hypersensitivity. Similarly, IL-1B has been implicated in human osteoarthritis pathogenesis. Patients with severe Coronavirus Disease 2019 (COVID-19) present elevated levels of pro-inflammatory cytokines such as IL-1B in bronchial alveolar lavage fluid samples. The lung damage induced by the Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is to a large extent, a result of the inflammatory response promoted by cytokines such as IL-1B. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, Jul 2020]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image