| ID | Sequence | Length | GC Content |
|---|---|---|---|
| NM_002276.5 | GCUCCUCCCGCGAAUCGCAGCUUCUGAGACCAGGGUUGCUCCGUCCGUG… | 1390 nt | 0.6180 |
The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. Unlike its related family members, this smallest known acidic cytokeratin is not paired with a basic cytokeratin in epithelial cells. It is specifically expressed in the periderm, the transiently superficial layer that envelopes the developing epidermis. The type I cytokeratins are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2008]
No forensic context available.