Basic Information

Symbol
KRT6A
RNA Class
mRNA
Alias
keratin 6A CK6C K6C CK6D K6D keratin 6C keratin 6D keratin 6A, type II CK-6C CK-6E CK6A K6A KRT6C KRT6D PC3 keratin, type II cytoskeletal 6A cytokeratin 6A cytokeratin 6C cytokeratin 6D keratin 6A, , type II keratin, epidermal type II, K6A type-II keratin Kb6 Keratin, type II cytoskeletal 6A Cytokeratin-6A CK-6A Cytokeratin-6D CK-6D Keratin-6A Type-II keratin Kb6 Allergen Hom s 5
Location (GRCh38)
12:52487176-52493257 UCSC Genome Browser

Secondary Structure

MANE Select
NM_005554.4
Sequence length
2308 nt
GC Content
0.5585

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-880.7 kcal/mol
Thermodynamic ensemble
Free Energy: -920.83 kcal/mol
Frequency: 0.0000
Diversity: 546.52
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((.((((((((...((((.((((((((.................((.((.(((((((..(((.(((((((...((((((((((((.(((((((.(((.((.(((.((((((..((.(.((.......))).))..)))))))))..)).))).)))))))..(((.(((.(((((((((......)))))).))).)))))))))))))...)))))...))))))).))).((((((...(((.((((((((.....((((((..((....)).))))))....)))....))))))))..))))))..(.((.((((((((.((....)).)))))))).)).).))))))))))).(((((((((....)))))))))....((((((((((((((((((...((((((...))))))((((((((.(((..(((((((..((.(((((((...)).))))).)).)))))))..)))..)))))))).((((..(((((....((((((.......(((.(......).))))))))).(((((..(.(((.....))).)..)))))......((((.(((((((...........((((.((((...(((((((.(....((((((((...(((...(((.(((((((.....)))))))..)))....)))....))))))))....).))))))))))).))))............))))))))))).((((....))))))))).))))))))))))))).))))))).)))))).)).))))...)).))))))(((((..........))))).............(((.(((((..(((((.((......))..))))).........(((((((((((((.........(((((((.((((........))))....((((......)))))))))))..((((((((((((.(((.(((((..((((..(((((........)))))..))))..)))))(((((((((((.(..((............))..).)))))))))))......((((..(((((..(((.((((((((..((((.....((((((((((((((((..((((.((((........)))).)))).((((..((....))..)))).....(((((..(((((..........))))).....((((((.(((.((.((.((((((((........)))).))))((((((((((((.((.(((((..(..(((.(((((((((((((((((((((.((((((.((((....((((((....))..))))........(((..(((((........))))).))).(((((.....)).)))..))))))))))......((.((((((((((((....))).))))...)))))))((((......)))).((((((.(((((((((((((((.........(((((.((.(((.(((.(((((.....))))).))).))).)).)))))))))..)))))))))))...)))))).....)))))))))))))))...)))))).).))..)..))).)).)).)).)))).)))))).....(((((((.((....)).))))))).(((((...))))))).)).))).))))))(((((((((((.((.((........................)))).))))))))))).(((((((...((((....))))......)))))))..))))).))).))))).))))......))))...))))..)))))))).)))))))).))))(((((((.(((((.(((.((((......))))..))))))))....(((((((((...(((((..........................((((((.....))))))..((((((......)))))).((((((....))))))....((((((((.......((((.........)))).......)))))))).........))))))))))))))..............(((((...........))))).....))))))).......)))..))))...................))))))))........(((........)))(((......)))..)))))))))))))(((((((((.(.((...(((.((.((.(((((.....))))).)))).)))..)).))))))).)))))))).)))............)))))).............
Thermodynamic Ensemble Prediction
.,,,((((((.((((((((,..((((.((((((((..(((.(((((((((((...(((((.(((({.(((.(((((((.,.((((((((((((.(((((((.(((.((.(((.((((((..{{.(.((.......))}.))..)))))))))..)).))).)))))))..(((.(((.(((((((((......)))))).))).)))))))))))))...)))))...))))))).))).((((((...(((.(((((,{{{,..{((((,,..{{..,,||.}}))))}}}})..)},.))))))))..)))))).,(.((.((((((((.((....)).)))))))).)).)}}}{{(|,{,({{(((,,,,.{{,((.((((.(((....(((((((((.,{({((((({.{{{{{{{{{,.,|||{|((({((((((,,.((,...,,.}.}.)))))).,|||}.}})))).)})))))))}}),)))))))))..)}).)))))).,.,}}.,)))))).})))).,..))))).))))).))))))))))).)))............,{{{,.......,{{{((((((((...........((((.((((...(((((((.(..,.((((((((...(((...(((.(((((((.....)))))))..)))....)))....)))))))).,..).))))))))))).))))............))))))))))}.((((....))))})}}..,||||,.,||||..,.)}).)}..)))))).)).))))...)).)))))}(((((..........}))))..,....,...,,({(,(((((.,(((((.,,,....,||..}}}}}.....,,..(((((((((((((.........{((((((.((((........))))....((((......))))))))))}..((((((((.,{{,,{{,(((((..((((..(((((........)))))..))))..)))||(((((((((((.(,.({............))..),))))))))))),..{,,((((..(((((..{({.((((((((..((((...,.(((((((,,((((((({{((((.((((........)))).)))){((((..,,....)),,}),|,{.{{(((((..(((((..........))))).....((((((.(({.((.(..((((((((........)))).)))){{(((((((({(.(({(((((.((,.(((.(((((((((((((((((((((,.(((|{.{(((,...,|||||,,..}}.,})},........(((,.(((((........))))).)}}..((((..||.}|.|.},,},|||)}))|......,,.{((((|((({{{....))),.))),,,)))))}}((((.....,)}}|.((((((.(((((((((((({,{.(((.((({.,,,..,{.(((.(((.(((((.....))))).))).))).})))).))),)}.})))))))))))...)))))),,,)})))))))))))))))...)))))),},}|,||..}},|}}.}),}}.}})),}))})),}}.,||(((((.{{.,,.)).)))))}}{(((((...)))))))},)}))).)))))){((((((((((.((.{(......................,,}})).))))))))))|.(((((((...((((....))))......)))))))}.))))).)))})))))),))}},,})))))).}.))))..)))))))).))}))))).))))..,{|||{{((((.(((.((((......))))..))))))||{((((({({{{((,,..,,||,..............,,,,,,,,...{(((({.....)))))}..((((((......)))))).((((((....))))))....(((((((({......((((.,.......)))).....).)))))))).........})))))))})))))}},.{,,{{{{{{{(((({...{{{{{...,,,))}}}..}})))))).}}}}}}}.{{,....,,,...........,,..)))))))).....,,,{{{........)))|{|,.....))}..))))))))))))){{{((((({,{.{,...(((.{,.((.(((((.....))))).))}).)))..,,.))))))),)))))))),)))..,||,......}))))).............

Transcripts

ID Sequence Length GC Content
NM_005554.4 AGUCCUGCUUCUCUUCCCUCUCUCCUCCAGCCUCUCACACUCUCCUCAG… 2308 nt 0.5585
Summary

The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified; the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. This KRT6 gene in particular encodes the most abundant isoform. Mutations in these genes have been associated with pachyonychia congenita. In addition, peptides from the C-terminal region of the protein have antimicrobial activity against bacterial pathogens. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Oct 2014]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image