Basic Information

Symbol
KRT81
RNA Class
mRNA
Alias
keratin 81 Hb-1 hard keratin type II 1 keratin, hair, basic, 1 keratin 81, type II HB1 K81 KRTHB1 MLN137 ghHkb1 hHAKB2-1 keratin, type II cuticular Hb1 hair keratin K2.9 hard keratin, type II, 1 metastatic lymph node 137 gene protein type II hair keratin Hb1 type-II keratin Kb21 Keratin, type II cuticular Hb1 Hair keratin K2.9 Keratin, hair, basic, 1 Keratin-81 Metastatic lymph node 137 gene protein MLN 137 Type II hair keratin Hb1 Type-II keratin Kb21 ghHKb1 ghHb1
Location (GRCh38)
12:52285913-52291534 UCSC Genome Browser

Secondary Structure

MANE Select
NM_002281.4
Sequence length
1929 nt
GC Content
0.6226

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-827.1 kcal/mol
Thermodynamic ensemble
Free Energy: -860.19 kcal/mol
Frequency: 0.0000
Diversity: 542.86
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......((((((((((((((((((((((((...(((((...((((((...((...((((....))))..))...)))))).)))))((((..((((..((((((.((((....(((((((.((.(((.(((((...(((((((.........(((((........)))))..((((((((.(((.((((((....)))))).)))..((....))(((((.(((((((((((((((((...((((....))))..))))))(((((..(((((..(((((.(((........))).)))))..)).))).).))))...))))))))))).)))))..(((......)))...........(((((...))))).)))))))).....(((((.(((..((.((((((((((..((((((((.((((.......)))))))((((..((...((((((......))))))....))))))(((.(((((...))))).)))((.(((((....))))))).))))).))).)))))))))..)))..).)))))))))))..))))).).)).)).))))))))))).))))))..))))))))...(((((((.....((((((((((.(((((((((((.....((.(.((..(..(.((((...)))).)..)..)).)..))...)))))))))))......((((((((((((.(((..((((.(.(((((.((((((((((((........))))....))))))...))))))).).)))).)))...(((((((.....)))))))....))))).)))))))))).))))))))))))))....((((.....)))).)))))))).....((.((((.....((((........)))).....(((((....)))))...)))))).(((....)))))))))))))..((((.....)))).))))))...(((.((((((....(((.(((((...))))).))).))))..((((.(((((((.((((.((...((((..((((..((((...))))....))))..))))...(((((((..(((((...))))).....(((((((.((.((..(((((.((((((((....))))......))))))))).))))(((((((..((((((..((((((((.((((((.(.....).))))))..)))..)))))......(((.((((((((..((((.((...)).))))..))...)))))).))).(((((((((((((((((((...(((((.((((.((((....)))).((((((((..((......))..)))))))).(((((((((.....(((((((((((((((((..(((((.....(((((...)))))...)))))..))))(((((((((..((..(((((.((((.((((......)))).))))))))).))..))).........)))))))))))))))))))((.((((..((((.((.....(((...(((((.((((((((((((((((...)))))).......)))).)))))))))))))))))))).)))).)).....)))))))))))))))))).)))).)))))..))))))))))((((....)))).((..........))............))))))..)))..))))((((((......))))))...((((((...(((........)))...))))))...)))))))...............)))))))....(((((((((....(((.(((((((((((.(((.......))).))))..(((....)))))))))).))))))))))))..)).)))))))))))...))))...........)).)))..
Thermodynamic Ensemble Prediction
..,(((((({{,,....))))))))|((((((.((((((...((((((...{,...((((....))))..}}...)))))).))))))..)).))))((((((((.{(((({.{((((((({(({((,{((((,..}||||,||}}}..,.{{(((((..,,....},))|.{((((((((.(((.((((((....)))))).)))..({....}}(((((.((((((((((((((((((.,(({((({.{||{{....))).,|)}}}||||||{((({(.(((,...,.}))})})))....},.,,}.)}))))}..))))))))))).)))))..{,,....,{|,|.......,,..(((({...))))).))))))))}.,..(((((.(((..((.((((((((((..((((((({{((((.......)))))))((((..({...((((((......))))))....}}}))){((.(((((...))))).))}((.(((((....))))))).))))).)))}}})))))))..)))..).))))))))))),})))))}),}},|}{|||||,.,{((.,,,,))}}))))}...||....,,,,},}),})))))}),,..,(((((((..,{(,,(({.(((({((((((.{{({(,(((((.((((((.......))))))).)))))...,..((((((((((((.(((..((((.(.(((((.({((((((((((........))))....))))))...))))))).).)))).))).{.(((((((.....))))))).,..))))).)))))))}))}.))))))((((.((((,,((.((((....((((((((.{{..{.((({(((,.....((((........))))}}}}.(((({....})))){{{|....))))|}}.},,)).))))))))..((((....,))}}{(((({{{.{((({{.((((....(((.(((((...))))).))).}}}}..({((({(,{{...,,{{{|,...((((..((((..((((...))))....))))..))))...{{({|{{..(((({...})))),,},,{{((((,,,({((,,(({((.(((({{{(..,,}}}},,,...|}}}))})}.,}|,|(((.{{{{({((,,{,((((((((.((((((.{.....|.))))))..)))..)))))..{{{|,,,.)))|,}}..})))|.))).))))}}}.,.}}.,})),)))}))..(((((((((((((((((((.,.{(((({{(((.{(((....)))).((((((((..{(......})..)))))}))}(((((((((..,,,(((((((((((((((((,.(((((.....(((((...))))).).))))),.)))){{{({,,.|}}}|..(((((.((((.{(({.{,{{.}}},,}}}}}})))|||...,|..|,||.||{}}}||})))))))))))}|{,{{{{..|{{{.{|.....{{{...(((((.((((((((({((((((...)))))).,.....}})).)))))))))))})})))))),)))).)).....}))))))))))))))))).)))).)))))..})))))))))((({..,,)))),}}}.,,))))))}),}}},,...,...}})}}},},,.}))))|{{|||}},.,,}}|||....,,|||({{((((....{{{.,||{,..,))))...))),,.)))}}},....))))))))))).)))),((((((((....,(({(((((((((((.(((.......))).))))..(((....)))))))))),))))))))))))))))))))))|{{|.|,,...,,.,,.......)))))))..

Transcripts

ID Sequence Length GC Content
NM_002281.4 CAUUGGAGUUUCCAUCAGGACUCCAGGUCCCCUAUCCUGUCCUCUGCAA… 1929 nt 0.6226
Summary

The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin, as well as KRTHB3 and KRTHB6, is found primarily in the hair cortex. Mutations in this gene and KRTHB6 have been observed in patients with a rare dominant hair disease, monilethrix. Some human genome assemblies (example T2T-CHM13) have a non-coding version of the gene due to the presence of a SNP that introduces a premature stop codon after codon 281. [provided by RefSeq, Jan 2024]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image