| ID | Sequence | Length | GC Content |
|---|---|---|---|
| NM_002281.4 | CAUUGGAGUUUCCAUCAGGACUCCAGGUCCCCUAUCCUGUCCUCUGCAA… | 1929 nt | 0.6226 |
The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin, as well as KRTHB3 and KRTHB6, is found primarily in the hair cortex. Mutations in this gene and KRTHB6 have been observed in patients with a rare dominant hair disease, monilethrix. Some human genome assemblies (example T2T-CHM13) have a non-coding version of the gene due to the presence of a SNP that introduces a premature stop codon after codon 281. [provided by RefSeq, Jan 2024]
No forensic context available.