| ID | Sequence | Length | GC Content |
|---|---|---|---|
| NM_002423.5 | ACCAAAUCAACCAUAGGUCCAAGAACAAUUGUCUCUGGACGGCAGCUAU… | 1119 nt | 0.4334 |
This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down proteoglycans, fibronectin, elastin and casein and differs from most MMP family members in that it lacks a conserved C-terminal hemopexin domain. The enzyme is involved in wound healing, and studies in mice suggest that it regulates the activity of defensins in intestinal mucosa. The gene is part of a cluster of MMP genes on chromosome 11. This gene exhibits elevated expression levels in multiple human cancers. [provided by RefSeq, Jan 2016]
No forensic context available.