Basic Information

Symbol
APP
RNA Class
mRNA
Alias
amyloid beta precursor protein alpha-sAPP peptidase nexin-II Alzheimer disease amyloid beta (A4) precursor protein AAA ABETA ABPP AD1 APPI CTFgamma CVAP PN-II PN2 preA4 amyloid-beta precursor protein alzheimer disease amyloid A4 protein homolog alzheimer disease amyloid protein amyloid beta A4 protein amyloid precursor protein beta-amyloid peptide beta-amyloid peptide(1-40) beta-amyloid peptide(1-42) beta-amyloid precursor protein cerebral vascular amyloid peptide protease nexin-II testicular tissue protein Li 2 A4 Amyloid-beta precursor protein Alzheimer disease amyloid A4 protein homolog Alzheimer disease amyloid protein Amyloid precursor protein Amyloid-beta (A4) precursor protein Amyloid-beta A4 protein Cerebral vascular amyloid peptide PreA4 Protease nexin-II

Secondary Structure

MANE Select
NM_000484.4
Sequence length
3583 nt
GC Content
0.4851

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1123.2 kcal/mol
Thermodynamic ensemble
Free Energy: -1189.52 kcal/mol
Frequency: 0.0000
Diversity: 1094.9
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.(...((.((((((((((((.((..((((((......))))))((((((((.(((((.(.((((((((((((((.((((..(.......)..)))).))....)))).))).).))..))).))))).))))).))).((((.((...)).))))(((((.((((((((..(((.((((.((.(....((.(.((..((((((((...(((((.(((((((((.((((((.((((((((.((((..((.((((..((((.((((..(((........)).)..)))))))))))).)).)))).)))))..))).))))........)).))))...))))).((..(((.(((((((((.......((....)).......)))))))(((((....))))).)).)))..))...)))))))).)))))..)).).))...)))))))))))))))))).)))))......(((...)))..)))))))))))))).))..).)))((((((.((..(((((.(((((((((((......(((...(((.....((((..((((((((..((((...)))))))))))).))))......(((........)))(((((((((((((((((((..((((((((.(....))))))..(((((((.(((((((....))))))).))))))).............((((((.(((...(((((((((((((.(((((((((....))(((((((..(((((((.((((((((((..(((((((((.(((...((((....))))........(((((((((((((((((((((.(..((..((((((.(.(..((((((((((((....((...........)).......(.((((((((.(((.((((((((((((.(..((((((((((....((.((((..(((....((((((............((((((.(..((((((...))))))..).))))))..((((....(((((.(.((..(((.......))).)).).)))))....))))..))))))..)))..)))).)).....(((((((.(((((((.(((((.((((.(((((((((...)))..........(((.((.(((((((..(((((((..(((...)))..))))))).....(((((.....)))))...(((((..(((......))).)))))....((((....((((.(((..(((.....))).))).))))..)))).(((.((((....((((.(((........))).)))))))).)))(((((.......)))))(((((((((....((((((((...(((((..((....))...)))))((((((....((((...(((((((((((......((((((((........)))).))))...((((........))))(((((.(((.((((((((((((((((((((((.((((.((((((((.....((.((((((.((((..(((((.....)))...))..)))))))))).)).....))...))))))..))))((((((........))))))((.(((((((((...(((((..((..((.(((((.............))))).))........))..)))))...)))))))))))(((((((((((...((.......))..)))))).....((((........)))))))))(((((((((....))))))))))))))))..((((.(((.(..((.(((......)))))..))))..)))).....))))....)))))))).(((..((.....)).)))...(((..((((((...((.......))...)))))).))).((((((.((.((.((((.((((.....((((.......))))......)))))))))).)).)))))).(((((((((((...)))))..))))))...(((((.(((((((((((.((((((((((........))))))...(((.((((.(((((((...((((((.((.(((((((((.((((((.............)))))).)))))...((((((((..(((((.....)))))...(((.(((((((.((....(((((......)).)))..))..))))))).)))....))))))))....)))).))..))))))...)))..)))).))))..)))....((.((((((((((.(((((.....)))))..))))))..)))).))(((.(((((.........))))))))..((((.....)))).((((((........)))))).))))))))))))))).))))))))))))))))..(((......)))................)))))))))))....))))...............((....)).)))))).....((((((((((.....))))).....(((....))))))))....(((((((((((((((.(((((......))))).(((((((.(((.((((..(((.(((((((...)))))..)).)))..))))..)))...))))))).))).)))))........))))))))))))))).....)))))))))(((((.((....((((.(((((.((((....((((((((((((.((((((.......))))).)..)))))))).......))))....)))).))))).))))...)).))))).))))))).)))))...(((........))).....)))))).)))).)))))...))))))).))))))).......)))))).))))..).)))))).............))))))))).)))))))).)................((((((((((((...))))).)))))))..))))))))))))..).))))))).))...)...)))))))))))))))).)))))..............(((((.(((......))).)))))))).))))))....)))...))))))))))))))...)))..)))))))(((((((((...(.(((....))))...))))))))).))))))).....))))))...)))))))....))).))))))))).))))))))((.((((.(((.....(((..(((((.....((((((.(((...))).))))))..)))))..)))....)))...))))))..))).)))))))).........................(((((..(((((.....((((((..((((........))))......))))))...)))))..)))))........((..((((.((((((((.....(((((((......)))).)))...))))))))))))..)))))...)))......))))))))))).)))))..))..))))))..(((((((((((.((((.....((((((.((..((((.....)))).)).)))))))))))))))))))))..
Thermodynamic Ensemble Prediction
.,{{.{..,((.((((((((((((.(((.((({(,{{.{{,},}|||((((((((.(((((.(.{{(({(((((((((.((((..(.......)..)))).))....)))).))).}.))..}}).))))).)))))}))),((((.((...)).))))(((({.((((((((..(((.((((.((,(....((.(.((..((((((((...(((((.(((({(((({((((({.((((((((.((((..((.(((,.{((((.((((..{((........)}.}..)))))))))))).)).)))).)))))..))}.||||........}},)})).},},))}.||..|||.|,(((((((...,...{{....}}.....,.))))))),{{((,...})))).}}.))).,)),..)))))))).)))))..)).).))...)))))))))))))))))).}))))..,}}}|.|..})),.))))))))))))))).}}..|,}}}((((((.((..(((((.(((((((((((......(((...((((....((((..((((((({..((({...}))))))))))).)))).....((((..({{{{{({((((((((.{,..((((....})}),,.),}))...))))))}.(((((((.(((((((....))))))).))))))).......((.((((((.,.{(.({.(((((((((..((((.{..(((((....)))))(((({{(..{|,,{.,{{{(({({{{(({{{(({{|{{({{{((({.,.{||||.,|||.,,((((((((((((((((((((({({,((,{{{{((,(({({,(((((,,{,,,({{{(.({{((((({...{{{{{.,,.{{(((((({({((((((,((,,(((((((({((,,,,,,,(,{..{(((,(({((.{..{{((((((.,((((((({(.{(((((.{..((((((...))))))..,.)))))}{{,{(((....,|||}},,,..,(({...}}}((((((((.,{{|......,,,..)))((((((((..((((.,,{(((.,..{{{(((((((((((........))}.}))).)))}.,},......)))}}.))))..)))))))}))))))))})).})))))}.|||.|,{{{{,.,{(((.{{{{,||||...{{(((..((({{,..{|||{|}|||,....,......((((.(((..(((.....))).))).))))}}},).}|||}}.|....(((((((((.{.......,,.},))))))))).(((((.......)))))(,{{{{{{|,..,|||||||....|||,,}}||.}}})})).))))).,,|||.,...,{{..{{{{.,,.,}))},,...((((,{,{,..{{{.{||,|{{||,..(((((,,,,,...}}},,}}}))))},,.||||||,|||..,.,,,,.||||,|}||||||.,.....((.((((((.((((..(((((.....)))...))..)))))))))).)),.........)),})})))))..))))}))},))}}))))))}(.(((((((((.,.(((((..{(..({.(((((..........,..))))).})........}}..))))).,.)))))))))),((((((((.{,....,....,,,.,..{{{{{((({,,.{((({{{{(((.,....))))((((((((....))))))))|((((({{.((((((..........,...)))).))..)}})))))|(((((((..,((((..((.(((((......)))))...))..)))},}..)))))))|....}}}}}}}.},},}))..))))).{((,(((.((.(({((,,.,,,|.,}}},||..}}}.}}),,...}}}}))))||||||.||{|,,,,..,|||||||||.,.,||||,..,,))))}..(((((.(((((((((((.(((({(((((........)))))}...{{{.((((.((((((({{.((((((.((.(((((((((.((((((,..,....,..,,)))))).)))))....,{,((,...(((((,...|))}||..,(,(.{,((((,.......||||...,.,})).)))}.}|{{|,,||||{,,,.....))))),.))}})))).})..))))))}},))),.}))).))))..}}}.,,.((,((((((((((,(((((.....))))}..})))}},,)))}.}}||{.(((((.........)))))|||,.{{{{,,,,,))))}||||||..,,,,,.)))))}.))))))))))))))).)))))(((((((,...{{..((({..((((.,..............,.((((((....((....)))))))).,......{{....)}))))))))..})))))))).....)).)))))))},))}}}})}},)))))..{{{((((({,,,,{(((..,,,,,...}}})))))}|||.....})))}}}}).))))}.(((((...)))))....{{(((,|,...,},.}}}))..,,..))))).},}||},.||,||}}}}.})))))))}}}}}))))))}),{{{{{,{{,,..{{{{.(((({.((((,...{{{{((((((((.,(((((.......))))).}..)))))))).....,.}})}..,.)))).})))).}}})..,}}.))}}}..,,||{{{,{{{|,,,|||},,....,,{|{{{{,{{||||{{||}.}|||,,{{,.}|||||)}}}}}}}}}}}}}})))))},))}||},}))))||||,|||..{{,,||}||||||,|||||}||,|,,,{,,,,{,......,||||||((((,..,|||||,|||}}||{,,,,,,)))),,)},..)))))},.,}||,|,,.,})))))))))))))).}}}))|||,|}|||,...,(((((.{{,...,{{||,.||||}((((({{....{{{{,,..})))))))))).)))}..,))}))},{||((({(({(((,,.|,{{{..,,})}|.,.))}})))))))))|||(((,({{||||{{,{|.||}}}}}}}))),)))))},)))))}})})}))}|||},,,...,,)),}}.})}))))...,,,,,,.{,,{{,,||{{|||,,....)))}}))}}...}.))))..))))))))).)},||||,,.,,..,,,................,|,,}}}}}}.}}.,,}||||}...}|}|{({.(((((.........,|||||...,)))|{,|{{({{((({,{,....,}}..})))))))..)),))))).))}{{({{{|.,........},,))))))}...))))...)))......))))))))))).)))))..))..)))))),,{{((((((((({((((.,...(((((({(,{{({,,..,}}),))}))}))}})))))}}))))))))))..

Transcripts

ID Sequence Length GC Content
NM_201414.3 GUCAGUUUCCUCGGCAGCGGUAGGCGAGAGCACGCGGAGGAGCGUGCGC… 3358 nt 0.4809
Showing 11 to 11 of 11 entries
Summary

This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. In addition, two of the peptides are antimicrobial peptides, having been shown to have bacteriocidal and antifungal activities. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2014]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image