| ID | Sequence | Length | GC Content |
|---|---|---|---|
| NM_002521.3 | AGGAGGAGCACCCCGCAGGCUGAGGGCAGGUGGGAAGCAAACCCGGACG… | 708 nt | 0.5678 |
This gene is a member of the natriuretic peptide family and encodes a secreted protein which functions as a cardiac hormone. The protein undergoes two cleavage events, one within the cell and a second after secretion into the blood. The protein's biological actions include natriuresis, diuresis, vasorelaxation, inhibition of renin and aldosterone secretion, and a key role in cardiovascular homeostasis. A high concentration of this protein in the bloodstream is indicative of heart failure. The presence of myocardial injury is a significant predictor of mortality in hospitalized coronavirus disease 2019 (COVID-19) patients, and there is evidence of increased levels of natriuretic peptide B in hospitalized non-survivor COVID-19 patients. The protein also acts as an antimicrobial peptide with antibacterial and antifungal activity. Mutations in this gene have been associated with postmenopausal osteoporosis. [provided by RefSeq, Aug 2020]
No forensic context available.