Basic Information

Symbol
NPPB
RNA Class
mRNA
Alias
natriuretic peptide B natriuretic peptide precursor B BNP Iso-ANP natriuretic peptides B brain natriuretic factor prohormone brain type natriuretic peptide gamma-brain natriuretic peptide natriuretic protein preproBNP proBNP Natriuretic peptides B Brain natriuretic factor prohormone Gamma-brain natriuretic peptide
Location (GRCh38)
1:11857464-11858976 UCSC Genome Browser

Secondary Structure

MANE Select
NM_002521.3
Sequence length
708 nt
GC Content
0.5678

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-259.5 kcal/mol
Thermodynamic ensemble
Free Energy: -271.2 kcal/mol
Frequency: 0.0000
Diversity: 255.38
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((..(((((..(((...)))..)))))........((((.(.((((((.(..((.((.((.((.((....)).)).)).)).))..).))..(((.(((((((...((((((((((((((.(.......((((.(((((((((((((........((.....)).....((((((....))))))...((((((....))))))..((((.(((((........))))))))).))))))))).((..((((((((((((((...))))....)))))))))).)).......(((((((...))))))).)))).)))).......).)))))))..(((((((..(....)..))).))))...(((((((.(((((...((........))...))))))).)))))..((.(((...))).))..)))))))....))))))).))).))))).))))....))))))))((((((((.(((........))).)))).(((((((((((((((((((((.((((....))))........(((((.(((.............))))))))..))).....)).))))..)))))))))))).....((..(((((((.(((((......(((((.....)))))..((((....))))......))))).)))))))..)).))))..........
Thermodynamic Ensemble Prediction
.,({(({((.,{((((,,(((,,,|||..|||||..,{...,{{((..{{.,.{{.((.{{.||.)).}}.,(((((((((..{{.(((((({(((..,(((.(((((((.,,|(({{{{((((({{,(,{{,...((((.(((({{{{{{((({{{{.{,,({,,,,(({,.,{{((((((,...}}}))},,.((((((....)}}}))..{(((.(((((........))))))))}.}}))}}}}},{{..{{{{{{(({{{||,...,))),,..)))))))})),)),}....,(((((((...))))))).)))).}}}}......,)})))))))..{{|||||,,{|..,)|,}|}.||||.,.(((((((.(((((...{(,.......})...))))))).)))))..||}|,....}))}))..))))))},,}}))))))}.))).,.))),.,||{|..,||||||,.((.((((.(((........))).)))).)).,...}|||}.}}}},)))))).}.,..)))))))))...{({{..|||.......,,,...))))))))}})}}},}|,,|||.}}}.,,}|,.((((((.....((..(((((((.(((((......,{{{{.,,,.}},,),,,{||,,..}}},......))))).)))))))..))))))))..,,,,,,.

Transcripts

ID Sequence Length GC Content
NM_002521.3 AGGAGGAGCACCCCGCAGGCUGAGGGCAGGUGGGAAGCAAACCCGGACG… 708 nt 0.5678
Summary

This gene is a member of the natriuretic peptide family and encodes a secreted protein which functions as a cardiac hormone. The protein undergoes two cleavage events, one within the cell and a second after secretion into the blood. The protein's biological actions include natriuresis, diuresis, vasorelaxation, inhibition of renin and aldosterone secretion, and a key role in cardiovascular homeostasis. A high concentration of this protein in the bloodstream is indicative of heart failure. The presence of myocardial injury is a significant predictor of mortality in hospitalized coronavirus disease 2019 (COVID-19) patients, and there is evidence of increased levels of natriuretic peptide B in hospitalized non-survivor COVID-19 patients. The protein also acts as an antimicrobial peptide with antibacterial and antifungal activity. Mutations in this gene have been associated with postmenopausal osteoporosis. [provided by RefSeq, Aug 2020]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image