Basic Information

Symbol
NR3C1
RNA Class
mRNA
Alias
nuclear receptor subfamily 3 group C member 1 GR glucocorticoid receptor nuclear receptor subfamily 3, group C, member 1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) GCCR GCR GCRST GRL nuclear receptor subfamily 3 group C member 1 variant hGR-B(54) nuclear receptor subfamily 3 group C member 1 variant hGR-B(77) nuclear receptor subfamily 3 group C member 1 variant hGR-B(93) Glucocorticoid receptor Nuclear receptor subfamily 3 group C member 1

Secondary Structure

MANE Select
NM_000176.3
Sequence length
6778 nt
GC Content
0.4035

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1880.5 kcal/mol
Thermodynamic ensemble
Free Energy: -2013.53 kcal/mol
Frequency: 0.0000
Diversity: 1769.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((..((((((((((((....((((((.(((..(((.(((((((((((((((.((.((.((((..((((((..((((((((.((.(((((((((((((...(((.((.(((((.(((((((....((......))....))))))).))))))))))...)))))).)))))..)).)).).))))).))..).)).)))..)))))).)).)))))).....))))))..((((..((((((........))))))...))))((((((((((.(((((((....((((((.(((((.....))))).))))))....)))).(.((((.(((((((..(.........(((((((.....))))))).........)..))))))))))).)))).))))))).)))......))).))).)))))))))...))))..)).)))))).)))))))..((((((((((((((((((((..((........))..)))).))))))).)))))))))...........(((((.....)))))...(((((((.((((((((((...(((((((.........(((((((.(((...((...((((.(((((((....((((((((((((((((((.((.............)).))))....(((((((........)))))))((.((........)).)).))))))...(((.(((...(((((((((.......))))))))).....))).)))..........))))).)))....))).((((...))))..))))))))..)).))).)))))))(((((...(((((....(((((((((.....(((((((...((((....))))....)))))))..........)))))))))(((((.....))))).)))))...))))).(((((...((((((....)))))).)))))..(((...((((((((((((.((((((.((((((...)))).))...(((((((((.....))))).))))..........(((..(((((((((((((.((((((((((.....))))))))))..(((((((((((((((((((((..((((.((.((......((.(((((.......))))).))((((((((.....))))))))....(((.((((....)))).))).(((....))))))).)))).))))))))).(((((((.(((...((........))....))).).))))))........(((((((........((((......))))....((((....((........))....)))).....)))))))..(((((((.(((..(((((((((((....))))...))(((((((((((((((((((....(((((.(((((((..((((((.(((((.((((((((...((((.((((.....)))).)))))))))))).....(((((((((..............((((.((((.(((((........(((((((...(((..(((..(((((.((.............)).))))))))..))).)))))))..((((((.....(((((.........))))))))))).(((((((((((..(((...((((.((....)).)))).)))(((((((.(..((((((.((((((((((..(((((....(((((.....((((.........(((((.((..((....)).)).)))))..........))))......)))))....)))))..))............))))..)))).)).(((((((........)))))))..))))..).))))))).((((......))))))))))))))).((((((((.(((((((((....((.((((((.(......).)))))).))))))....................((((.(((((.(((((......))..(((....)))..))))))))..))))((((((....((........))....)))))).................))))).)).))))))))))).)))).))))..((..(((((((((((((((((..((((((((((((........((((((((((.....(((((..(......)..)))))....))))))((.((((((....(((((..((..((.((((((.............))))))))..))...)).))))))))).)).)))).(((((((......)))))))..)))))))))))))))))))...((((((.(.(((((.(......).))))).).)))).)).........(((((.....)).)))...))))))))))..))............))))))))).((((((((.....(((..(((((.((((...(((((.((((...)))).)))))..)))).....(((..((((((((..((.......)).))))))))..)))((((.(((((((....(((......)))))))))).)))).....)))))..)))..))))))))(((...)))...))))).))))))..)))))))...((((((....(((((((((((((.((((.(((((((((........)))))))))...((((((....))))))......)))).)))..))))...))))))))))))((((.((((((.............(((((((..((.(((((((((..(((((((((.((......)).))))((((..(((..((((.........)))))))..))))(((.(((((((((((((.(.(((((((...))))))).).))))))))..))))).)))..)))))..))))))))).)).)))))))..........(((((....(((((((....(((((((.((((((((..........))))))))...((((((....))))))((((..(((...(.(((......))).)...))).))))............((((....((((((.(....))))))).......)))).)))).)))))))))).))))).....((((((((((.((((..((((.((..((((((((((((((..(((((((........))))).))..)))).((.....))...((.(((((((((((((......)))))).))))))).))......))))))))))...((((((((..(((..((((((((((((((((....((((......))))..)))....)))))))))).....)))..)))..)))))))).((((((((..((((((.......(((.(((((((((((..((..(((((...((((.(((((.....)))))..))))..))))).))..))((((((((((.....((((((((((((((((((.(((((.....((((((.....)))))))))))))))......(((((...................)))))...............(((.(((.((((((.(((((.........((((((.(((..((((((((........)))).))))(((((..(((.....)))..))))).......((((((((...(((.((.(((((......)))))...........(((((((((((((.((((............(((...(((((((.(((....))).)))))))....)))...............)))).)))))))..))))))..((((((((.....))))))))............(((((((...)))))))(((((((((.........))))).....)))))))))...)))))))).....))).)))))))))))))))))))))))....))))))))))))))...............))))))))))((((((((......)))))))).((((...))))..((((((.((..(((((.((((.((.((((....((.((((....)))).)).....)))).)).)))).)))))))))))))....(((((....)))))((((((((....)))).)))).....(((((((((((((((((((.........(((..(((..(((((((..............(((((..((....(((((......(((((.......)))))))))).....))..))))).))))))).((((((..((((...((((((((((..........))))))))))...))))......))))))...........((((((....)))))).)))..))))))))))))))))))))))...(((((((.........))))))).))))))))).)))))))))...))))))))......)).))))..)))).....((((.(.(((((.......))))).))))).....((((..(((.((((.(((((.....))))).)))).)))))))))))))))))...)))))).))))..)))))...))))))))))))(.(((.(((((((.((((((((.(((((((((((.(((((((((((.((......)))))))).....(((((((.....))))))).................)))))(((((.....)))))..))))..))))))).)))))...))).)))))))))).)......((((((((((((.((....((((.......(((((((((((..........)))))))))))......((((...(((((..(((((((((((((((...((((.....))))((((((((..((((((((((((....))))....(((((((((((.(((....))).)))..(((((...)))))(((....((((((((((((((((.................((((((....))))))..(((((((......)))))))...(((((((....(((((........)))))..)))))))((((((...(((((((....(((.(((....))).)))))))))).)))))).))))))))..............)))))))).....)))............))))))))......(((((((((.((....)))))).).))))..)))))))).....))))))))...((((((.....(((((.......)))))))))))..(((((((((((..(((((...((((((..(((......(((((((((....((((....((((...............))))...)))).((((((.((((((((((((((........(((....))).......))))))....(((((((...(((...((((((((.(((.((((.(((((...(....)..)))))......(((((....((((((....))))))..))))).((((((((...))))))))........)))).))).))))))))....)))......)))).))).....((((((.....)))))).......(((((.((..((((........))))...)))))))((((..(((((((((((((((((((((....))))))).)))))))...))))))).)))).((((((((..((((((((((...............((((......))))..............))))))))))...............))))))))..))))))).).))))))....))))))))).....(((...((.....))...)))(((.(((((.(((....(((...(((((((.....((((((......((((((((...((((((.......))))))...(((((..((.....(((((((((((.....((((((...))))))))))..((((.........)))).)))))))))..))))))))))))).......))))))...))))))).)))...))).))).)).))))))..))))))))))).)))))))))))......(((((.....(((((((.......)))))))...))))))))).))))....((((..((((((((.((((((....(((((((((.((.........)))))))))))....(((.((((.....)))).))).)))))))))))...)))..))))((((....))))))))))))))))..))))))))......)).)))))...))))))).......((((((.(((.........))))))))).((((((((((((((((......))))).........))))))))))).....))))))).....(((.((((((.((((............)))))))))).)))..)))))..))).))))))).........((((((.((.(((((((...))))))).)).)))))).............)))))))))))).....))))))))))))).)))........(((.(((((((.........))))))).)))))))))))))))))))))...)))......(((....)))......(((((((((((((.....))))))).....)))))).)))))))...)))))).........)))).))))))).
Thermodynamic Ensemble Prediction
(((({,{(,.((((((((((((..{,((((((.(((..(((.(({((((((((((((.((.((.((((..((((((..((((((((.((.(((((((((((((,{{(((.((.(((((.(((((((,{..((......)).,,.))))))).)))))))))).}})))))),,))))..)).)).),})))).))..)}}).)))..)))))).)).)))))).....))))))..((((,.((((((........)))))).,,))))((((((((((.(((((((....((((((.(((((.....))))).))))))....)))}.(.(({{((((((((..{.........{((((((.....))))))}.........,..))))))))))).)))).))))))),,}}......,)).))).))))))))}.},))))..)).)))))).)))))))..((((((((((((((((((((..((........))..)))).)))))))},))))))))..,,....,..(((((...,,|}}}|..|{{(((((,(((((((({(...{(({{{{....,,,..{{{{(({,{{,.,|{,,..|{|||{{||{||,,..|||||{(((((((({(({,((......},.....,},}||}.,,.(((((((........))))))){|},,,,..}}..,),)).))))))}|.(((.(((...(((((((((.......))))))))).....))).))),.........,||}},|||....}}}.{{{{...))))..))|||||,.....,))}))}}}}}(((((...(((((....{((((((((.....,((((((...((((....))))....))))))},....,....)))))))))(((((.....))))).)))))...))))).{((((...((((((....)))))).))))|,,(({,,,((((((((((((.((((((,((((({...}))).))...((({(((((.....))))).}))){{{,......(((..(((((((((((((.((((((((((....,))))))))))..(((((((((((({..{.((((((((((((((((((((((((((.{.((.({{,..(((((((((((((((.....))))))}|,{({(((.((((....)))).)))..}}|{,{((((,,,...,||}|}}}}}},.(((((((.(((...((........))....))).).)))))).,,||,..((((((({..(((..,{,((({{{{,|||....((((....((.,....}.))....))))}}}..,)))))),.....))}.,,...||||}}},|||,,,.))}}{{{{,..,,.,|)))}}}))))}}}....(((({,,,...,,..|}})}.{{{(({((((({{({{.((((.((((.....)))).))))))),}},,))}))},,,,},,....}})))}.,))))))).}},{{,......,,,...(((((((...(((..(((..(((((.((.............)).))))))))..))).)))))))...}}}..)))))))))))))).}.,((((((((.(((((.(((((((((...((((.....))))......,(((((({(((((((.(..((((((.((((((((,{{..,(((..({.((((.....{............|||),})}}}||}}.,}|.||{|||||{,...,,..}))))},},...|||.(((((((....)))}}})..}},..))))..)))).)),(((((((........)))))))..})))..).))))))).((((......))))........((((((((((((((.((((.(((({{((.((((((.{......,.)))))),||.,||{,{(({..(({{{.{((((((({((..(((((((((.((((((({.,,{,...{|,,{{{|{|{{.....,{((((((....{{........|}....))))))|,,...((((........))))....}}))))|||||.,,||||||{{{{({{(((((,,,,,)}})}}},,.{{{{,,,}))},,.{((((((((((.((({,,..(({{{.,(,,..,,|,,|}}|}((((,.,.))}).((((((....(((((..((,,{{.((((((...{{...,,...))))))}),.))...)).))))))))).}}.}}}}}|{|||||......|||}},,)}}..(((((((((.((((....,,...{,.{,(({.,..}}}.,,,|||{((((.{{{{......}}},..))))))),.)))))))))))))((((((,..{{....))....)))))).})))).,))))))))))}....,|||}}}||||.|,{{{{{.((((...)))).}}}}}..,,},,,,,,|||,.((((((((..((.......)).))))))))..|||((((,((((((({{{.{(({,...{{{{},||,,.,)},)})).{(((((.((((({.,..((..(((...)))..)).....)))))).)))))).{((.((((((...{((,,((((((.(({({((.(((((((((........))))))))).,.((((({....})))))......)))}.))),.)))),}},,))),)))))).))}....,,,........|||,,{{..,{|..,...|||,,,||,.......,|}}})}))}}})),},,|((((..(((..((((.........))))}))..))))|....,|||||||||,,.,.{((((({...)))))))))))))).)))}})))))..)).})))))))).))))).}.))}),)))}),,,.......(((((....(((((((,...{((((((.((((((((..,....,..))))))))..{((((((....))))))|(({..{((,,({{{({...}))))}.,,,.,,..)))},...........((((....((((((.{....})))))).......)))).)))).)))))))))).))))).....{{{{{{(((((((((..((((.((..((((((((((((((..(((((((........))))).))..)))}.((......},,.{(.(((((((((((((......))))))}}}))))).))......))))))))))...((((((((..(((.,((((((((((((((((....((((......))))..)))....)))))))))))}...}))..)))..)))))))).((((((((..((((((.......{{{.{{{{{{((({((((({(((((,,,,((((.(((((.....)))))..)))}...,,,,.,,....{,{{{{{{{,.....((((((((((((((((((.((((,...,(((((((.....)))))))))))))))......{((((..............,,...))))}...............(((.{((,({{{{{,{{||{,,||,....{(((({.,{{..((((((((........)))).))))(((((..(((.....)))..))))).......((((((((.,,(((,,,,(((((......))))}...........{((((((((((((.((((...{,,,.....(((,,.(((((((.{((....))).))))))),},.))}....,,...|.,...)))).)))))))..)))))}..{{((((({.....)))))))),...}},,....{((((((...))))))|{((((((({.........}}))).....)))))}},,...)))))))).....,,,.)))))},},}|}))}}}})))))....))))))))))))))...,,..|,....,.}}}))}},,,((((((((......)))))))).{{{{...))))..,(((((.,,,,(((((.((((.((,((({...,||,||{,....|||||||.....)))),)).)))).))))))})))))}....(((({....})))){{({{{{{....|})},}})).....(((((((((((((((((((({...,...,,,,,{{,..,{{{{({..............{((((..{{....(((((..,.,,({{{{...,...}}}}}))))).....}}..))))).}}}}}}|.((({{{..((((,,.((((((((((,.....,...}))))))))),,.))))...,,,))))}|,,..,,,{{{.,{||||,,..}}},}}.)))..,)))))))))))))))))))))...{{(((((.......,,))))))),))))))))),)))))))))...))))))))......)).))))..))))})))))|}),......}}}})))}.)))).))).......}}}))}(((.{(((.(((((.....))))).)))).))),....,.....)))))...))))))))))))..)))).)))))..))))))))||.(((((((,((((((({.(((((((((((.{,{{{|{{|{(,((,{,{.{|,,,))|}|}...(((((((.....))))))),}}}.....,,,,.,..,,,,|(((({.....)))))).)))),,))))))).))))),,.))).)))))))}|(({(........}}}},,|,,,.((((((((((.({((.(((((((((((..........)))))))))))....{.((((,,.{((,.{{(((((((((((((({,..((((.....)))){(((((((..{{{{{(((((({{.{{(({{{{{.,{{(....||,.|||}}}})),.}|},|,,|||}.,|||}}||||,..,{((((({,{{{{{{{,,...,,....,.{{{{{{(({{,,,.,,,,,|,.(((((((......))))))),}}|{{,{{{,,||{{{{{{{,..,{,|||,|{{,,,.|{{((((((...((((({{..,,{{{.{{,...,))}.}}}))))))).)))))))))},)))}}}}}},..,,,..,}|||}}}}.},|,|||,|||.....,,})}}})))},.,,..{||{{((({,({....}})))}.}.}}}),}}}}}}|}}.....))))))}}...{{{{{{.....(((((......,)))))}))}}},,{((((((((((..(((((,..((((((..{({{({,(((((,(((({,..,{{{{||,{({{........,...,,..|)))....,|,}||||||,,{{,{{{|(((({(.,......{{|..,.))).,.,}}.))}}}),,,.||,|{((((((.{,..,,||}}},}},,,}}||}||{,...}|}||,|||||||||...,,|||||,,{,((((((....)))))).}))),,.((((((((...)))))))){{,{{..,})))}},,.||||||||||||{|,|,.,,.{((({(((({...({((((...,,||||}}....,||||||(,{{,.(({{....,.,.)}}}...}}|||||{|,,.,}|||||(((((((((((((((....))))))).)))))))}..,}}}}|{{{{{{.((((((({..((((((((((........,,...,.(({{......}))},||......}}...))))))))))............,..))))))))..,))))))},.....,,.,,.))))))),))),,||||}}}||}|,.|}|}|||||{{(,(((((.(((....(((...(((((((.....((((((......((((((((,..{{((((.......})))},...{((((..(({....{((((((,,{{.....((((((...)))))),,}|..{{{{.........))}}.)))))))))..))))))))))))).......))))))...))))))).)))...))).))).)).))))}},,))))))}))))}))))))))))}.,,,,||((((...,.{((((((.......)))))))...))))))))).))))....((((..((((((((.((((((..,.(((((((({{((.........)))))))))))....(({,(({,....}))}),)}}.)))))))))))...)))..))))((((....)))))))))))))}}}..)))).,.......,,||||||,...,{{({(({{{....,||{{,...||||}|,,,..})})}.,..((((((((((({((({......}}},}......,,,))))))))))).....{{{|....}}}.{((.((((((.((((............)))))))))).))}..}}.,),.))))))))))...,,,..,,,{{{((.{|.(((((({...))))))).}}.)))))},,..........})))))))))))).....))))))))))))).)))......,,}}{{(((((,{.........,)},)))})))))))))))))))))))||,..}}}............,})}.,,...(((((((((((((.....))))))).....)))))).}}))))),.,)))))}..........})),))))))).

Transcripts

ID Sequence Length GC Content
NM_001364185.1 ACAAGCUAAGUUGUUUAUCUCGGCUGCGGCGGGAACUGCGGACGGUGGC… 6985 nt 0.4142
Showing 21 to 21 of 21 entries
Summary

This gene encodes glucocorticoid receptor, which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image