Basic Information

Symbol
PDIA3
RNA Class
mRNA
Alias
protein disulfide isomerase family A member 3 P58 ERp61 ERp57 ERp60 GRP57 PI-PLC HsT17083 glucose regulated protein, 58kDa protein disulfide isomerase-associated 3 protein disulfide isomerase family A, member 3 ER60 GRP58 HEL-S-269 HEL-S-93n protein disulfide-isomerase A3 58 kDa glucose-regulated protein 58 kDa microsomal protein ER protein 57 ER protein 60 disulfide isomerase ER-60 endoplasmic reticulum P58 endoplasmic reticulum resident protein 57 endoplasmic reticulum resident protein 60 epididymis secretory protein Li 269 epididymis secretory sperm binding protein Li 93n phospholipase C-alpha ERP57 ERP60 Protein disulfide-isomerase A3 p58 Disulfide isomerase ER-60 Endoplasmic reticulum resident protein 57 Endoplasmic reticulum resident protein 60 EC 5.3.4.1
Location (GRCh38)
15:43746394-43773279 UCSC Genome Browser

Secondary Structure

MANE Select
NM_005313.5
Sequence length
3680 nt
GC Content
0.4342

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1058 kcal/mol
Thermodynamic ensemble
Free Energy: -1125.44 kcal/mol
Frequency: 0.0000
Diversity: 1007.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.(((((((.((.((((((..((((..(((.(((.((....(((.((.(.....).)).))).....)).))))))..))))...))).))).))..)))).)))))).(((..((.(((....)))))..)))((.((.....)).))(((((((...(((..((..((.((.((((..((.(((.((((.......)))).))))))))).)).))))..)))...)))))))(((((((((...((((((.((((....)))).))).)))(((((...)))))...))))))))).((((.((.((((...(((..((((((.(((((((......(((((.((((((((((.....((..((((.....(((((((....((((.((........))))))..))))))).....)))).))..))).))))....))).))))).((.(((((...(((((((((.(((.(((....)))..)))..)))...(((((((.(((...))))))))))..((((((...))))))...(((((.......(((((..((((.((((........)))).))).)..))))))))))...))))))....))))))).......((((((((.((((..((((((.((((....))))))))))..))))....(((((.(((((((..........))))))).))))).))))))))..(((((((....((((((((((.(((((((((.....))))).............(((.((((........(((((.(((.(((.....(((((((((.(((((..((((((.(.(((((.((((((((.((((........))))..))...))))))))).)).).))))))..........((((.......))))..((((((((((...........(.((((((((((......(((((.(((......(((((((...((((.((.((((((((.((((...(((((((..((..((((((((.......))))))))))..))))))).........)))).))))........)))).)).)))).)))))))))).)))))((((((.((.(.....).)).))))))(((.((((((((.(((((((.(((((((....))).)))).))).)))).))...)))))).))).(((((((....(((((((((((.(((....(((.((((((...(((((.((((((((((.((((((........(((((((((.((((((((.((((..((((((.(((((((((.............((((((((((((((.((((.(((...((((((...(((((...((((.(((((((....(((((.(.((((........)))).)...)))))..(((((..(.(((......))).)..)))))..(((..((((((.(((......(((.........((.(((((((.(((((.........)))))..))))))).))....((((((((((((((.(((((..(((.........................)))...))))).)).........((....))......(((.(((((...((..((((((.......(((((.....)))))))))))..))....(((....)))........((((((......))))))))))).)))..((((.(((..(((((.((...(((((.((((((((.........)))..))))).))))))).))))).))).)))))))))))))))).))).......))).)))))).)))...))))))).)))))))))..))))))....))).))))..))))))))))..)))).))))))))...(((((((((...........))))))))).)))))))...((((((.....))))))......(((((((((.................)))))))))..((((((((((..((((.((((.....)))))))).))))))))))....((((((((((((((..(((....)))(((((.....)))))......((((((((((((((...))))...))))))))))(((((((((((((((.((((((((.....((((((((((.........(((((.((((((.((((((..(((((...(((((((.....))))).))...)))))(((((((((........((((((..(.((((((((((.((..(((...((((.......((((((....((((((.....(((.((((...........))))))).....))))))....(((((....)))))))))))....))))...((((((.((.((.((((......)))).)).))))))))..........))).....)))))))))))))..))))))...)))))))))..(((((((((.((.....)).)))))))))..(((((.......))))).............))))))..)))))))))))(((((((((.((.....(((..((........((((((((.(....).))))))))........))..)))...)).))))))))).(((((....)))))(((((...))))).(((((....)))))((((......))))...))))))))))..........((.(((((((((.....))))).)))).)).)))))))))))....)))..........((((((.((((((((.........((((.....))))..(((((............)))))..........((((((((((((......((((.(((((....)))))...)))).....))))))))))))....(((((((..(((....))))))))))..))))...)))).))))))...(((.....)))..........))))))))).....))))))))))))))))))))))))))...)))))))))((((...)))).((((((..............)))...))).....((((..(((...)))..)))).)))))))))))))))).))))).((((.((((((((((.......))))))))))..)))).......(((((.((...(((((((((((....))))).))))))...)).)))))(((((((................))))))).)))))).)))...)))(((((((..(((...)))..)))))))...))))).)))))).............................(((.((...)).)))..)))))))..)))))))))).).)))))))))).((((((((...((((((((((((.(..((....))..).)))))).))))))..)))))))).......))))).)).)))))))..))).))))))))....)))).))).)))).))))))))))...)).)))))........))))))).))))))..))).))))))..))))((.((((((..((((((((.(.........).)))))))))))))).))...)))............................
Thermodynamic Ensemble Prediction
.(((({((({({{.(((((((((({{{(.(((((((.((.((......{{.......}}}).)))))))))}}.,.))))...{{(((((.....((.(((...((({....)}}))...))).}).....))))),)))))))))},,}))}))(((((((...(((..((..((.((.((((..(,{(((.((((.......)))).))))))))).)).))))..)))...)))))))(((((((((...,(((({.((((....)))).))),,}|(((((...)))))}..|)))))))}.((((.{{.((((...(((..((((((.(((((((,,..{,(((((.{(((({((((.....{{..((((..,..(((((((....((((.((........))))))..)))))))..,..)))).|}..}}}||})}....}}},})))}.{{.{{(((||,{{{{{{{({,({(.(({...,|||,.||}..},)}.}|||||{{,(({|..}}}|||||||{{,,(((.,{{|||||,{{{(..((.......,,{||..}}}}.}))}))}}.}}},,))).}))))}||||||||}}.,.})|}}}....}}}}}}}.},.,,,|{{(({,...,{,,,{(((((.{{{{....)))))))))),,,}}}|.{{(((({.(((((((.{......,.))))))).))}}})))}}}))},.|{{{{,,....((((((((((.(((((((((,,...}}}}}..,.......,..(((.((((...{,...{(({{{(((,(((,,...{(((((({(.(((((.,{(((((.(.(((((.((((((((.((((........))))..)),..})))))))).)).).)))))}..........((((,,.,,,{|}}|..{(((((((((...,,......,.{((((((({{,|...,||||{,|{(,,,{,,((({{{{...{{((|({,{{{{,|||.||,....(((((((({.{{.{,,,.,}.}},}}}}},})}}(((((.((.((({...,))).)).)},)))..,,,,.,,)))}.}},}}}|.}}||||||||{|||||{{,,||}|{}|}}},}|||,.,|||||(((.((((((((.(((((((.(((((((....))).)))).))).)))).))...)))))).))).|||||||....(((((((((((.(((.,{.(({.((((((..,(((((.(((((((({{{((((({........{((((((((.((((((((.((((..{(((((.{((((((((......{{,{,{.(((((({{,,,,,|}||||.{{{,,,{{{{{(...((({{...,,{(|((,{,|{...,{{{{{.{,((((........)))),},|,))}}}..(((((..{.(((......})).}..))))},||||||{,..,,.....{{,..{,{{,{|,,,..,{,{{{|||{,.(((({{,.,.,..,},..{((((.(((....,}),}))))}..,,,{{{{{{,|,.||{,.....................,..}},,,,||}|}|}}.|||||,,.{{{{,.||{{{{.{{{{({{{{,...|{..,{{((((,,{...|||||,....}}}|}|||}}},.,,....(((....)))........((((((......)))))),||||.,{(((((({.(((..(((((.,,..,(((({.(((((,((..,......},},.))))).)))))},.))))).))).}))))))}))))))))))......,,.,))))}))))))}...,})))))),))))))))),,)))}})},},})}})},}.,)))))))},},,}))).))))))))...(((((((((...........))))))))).,)))))}...((((((.....))))))......(((((((((,,,....,,,.......)))))))))..((((((((((..((((.((((.....)))))))).))))))))))....((((((((((((((..,,{....}}|{{{{{.....}}))},.....((((((((((((({...})))...))))))))))((((((((({{((({.{(((((((.....{((((((((({........(((((.((((((.((((((..(((((...(((((((.....))))).))...)))))(((((((((,,......{,,|{|..{.((((((((((,((,{(((...{{{{..,,,,.((((((,...((((((.....(((.((((...........))))))).....))))))....{((((....)))))))))))..,.||||,{{({{{{.,{{.{{.{{{|,,,,,,)))).||,||}}}}}),}},......}}}.....},))))))))))},.},,}},...)))))))))..(((((((((.((.....)).)))))))))..(((((.......)))))......,......))))))..)))))))))))(((((((((.({.....{((..{{........((((((((.(....).))))))))........})..)))...}).))))))))).(((((....)))))((((({..|||}}.,{|||....))))}((((......)))).}}}}})))))))..........,,.{((((((((.....))))).)))}.,,.)))))))}}}},...|||,{,,,{,...(({(((.((((({{,.....,...((((.....))))..,{(((,,.....,,...|||||..........((((((((((((((((.,,,,,.(((((....)))))}.}))))......}))))))))))....(((((((..(((....))))))))))..}}}}.,.})}}.)))))}..,}}}}},..,})),}.,.....))))))))).....})))))))))))))))))))))))))...))))))))|((((...)))).(({,,,...,..........,})...}}}...,,{{{{..{{{,,,|},..)))},)))))))))))))))).))))),((((.((((((((((.......))))))))))..)))).......{((({.{(,,.(((((((((((....))))).))))))..,)),)))))(((((((..,,,....,,.....))))))).)))))).))).,.)))(((((((,,({{...})),.)))))))...))))).))))))........................,,...{||..,..,}}.}))||)})))}}..}))))))))),,.)))))))))).{{{{,,{{.,{((((({(({..{,...}},,,,.)),,.}}})))}))}),,}}}))))))},......))))),)).)))))}),.}}).))}}}))).,,.)))).))).)))).))))))))))..,)).}))))}}}}}...))))))).))))))..))).))))))..))))((.(((((,.,((((((((.{..{....,.}.)))))))))))))).))...)))............................

Transcripts

ID Sequence Length GC Content
NM_005313.5 AGACGCGCGAGCGCAAGCAGCGGGUUAGUGGUCGCGCGCCCGACCUCCG… 3680 nt 0.4342
Summary

This gene encodes a protein of the endoplasmic reticulum that interacts with lectin chaperones calreticulin and calnexin to modulate folding of newly synthesized glycoproteins. The protein was once thought to be a phospholipase; however, it has been demonstrated that the protein actually has protein disulfide isomerase activity. It is thought that complexes of lectins and this protein mediate protein folding by promoting formation of disulfide bonds in their glycoprotein substrates. This protein also functions as a molecular chaperone that prevents the formation of protein aggregates. [provided by RefSeq, Dec 2016]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image