Basic Information

Symbol
PPBP
RNA Class
mRNA
Alias
pro-platelet basic protein SCYB7 TGB NAP-2-L1 LA-PF4 MDGF LDGF Beta-TG CTAP3 CXCL7 PBP b-TG1 TGB1 CTAPIII NAP-2 platelet basic protein beta-thromboglobulin connective tissue-activating peptide III neutrophil-activating peptide-2 chemokine (C-X-C motif) ligand 7 CTAP-III TC1 TC2 THBGB THBGB1 C-X-C motif chemokine 7 CXC chemokine ligand 7 leukocyte-derived growth factor low-affinity platelet factor IV macrophage-derived growth factor neutrophil-activating peptide 2 small inducible cytokine B7 small inducible cytokine subfamily B, member 7 thrombocidin 1 thrombocidin 2 thromboglobulin, beta-1 Platelet basic protein Leukocyte-derived growth factor Macrophage-derived growth factor Small-inducible cytokine B7
Location (GRCh38)
4:73985966-73988276 UCSC Genome Browser

Secondary Structure

MANE Select
NM_002704.3
Sequence length
1307 nt
GC Content
0.3565

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-279.8 kcal/mol
Thermodynamic ensemble
Free Energy: -308.07 kcal/mol
Frequency: 0.0000
Diversity: 283.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((....)))))).(((((.....((((.....))))..((((((((((((...(((.(((.(((((.............)))))...))).))).......(((.((((....(((((.(.(..((((((..((..((((((.((....)).)))).))..)).....((((.((((((((((((......((......)).........(((.(....).))).)))).))).)))))))))((((((..(((((((.((((..(..(((........)))..)..)))).))))((((....((.(((((...))))).))....))))..((...))...)))..))))))))))))....)).))))).)))).)))..((..(((((........)))))..)))))))))).))))..(((((.((((..(((((((((((.....))))))))))).....(((((((((((((((....(((((((((((.....((((((((((..(((....((((.....((((((...(((.((((((((((((...........))))).....))))))).)))....))))))..))))...))).)))))))))).....))..)))).)))))))))))))....((((((((...........(((((((......(((((((((((........))............((((((......)))))).((((...((((.((....(((.((((......)))).)))...)))))).)))).....((((((.((((((........)))))).)).))))...)))))))))..))))))).((((((((.((((.....))))..)))))))).....((((((((..(((..(((((((...((.((...(((((((...(((((((((((..........(((..(((((((((((((.(((((((((..........)))))))))......((((((((((...(((.((((((((.....)).)))))))))....))))))))))(((((((((.....(((..((.......))..)))......))))).))))...........))))))))))))).))))))))))).)))...)))))))...))))....)))))))))))))))))).......)))))))).))))))).........................................))))))))).....(((....)))........))))).....
Thermodynamic Ensemble Prediction
.....,(((((....)))))}.(((({.....((((.....))))..((((((((((((...(((.(((.(((((.............)))))...))).)))....,..(((.((((....(((((.(.,..((((((..((..((((((.((....)).)))).))..)).....((((.((((((((((((..,,..,|,.....||,,,.....}}|||{....,,}...))))}}}),)})))))))((((((..(((((((.((((..{..(((.,......)))..}..)))).))))((((....((.(((({...})))).))....))))..{{...}}...)))..))))))))))))....}).))))).)))).))).||{..(((((........)))))..}}))))))))}}))}..,{{{(,((((..(((((((((((.....))))))))))).....{{||||{((((((({..,,(((({{{{,,,{||,,||||||||{{{{((({,...{{{.,}},.|||||,.,||,.,,|||||||{{{.|||||,...,},,,,.....,}}}}}}.}}}...|},|||,{((({,{{{,....,,}}..,.)))))})).,))}||||||||)))))||,,..((((((((.......,...(({{(((,,,.,,((((,,{{,{{.....,,,)),.{(({...,}}|,{(((......))))},.,,,,...{{{,.{,....|||,||{{....,.)))}.}}}...}}}}},.}))}..,..{{{(((,({((((..,,,,,,}}}}}}.}},,})),..}})))))),.,)))}))),|,,{{{{,.,,,,.,,.,,,,|.,,}}}))),.....((((((((..{{{..(((((((...((.({...(((((((...(((((((((((...........,,..(((((((((((((.(((((((((..........))))))))).....{((((((((((...(((.((((((({.....}).)))))))))....))))))))))}.,,(((((.......{,,{(,,{,...,,...,,..,,},))))},|||,.......}}}}))))))))))))).}}.)))))))).)))...)))))))...}),,.,..)))))))}}})))))))).......)))))))).}}}}}}),,,,..,,,,,|||||......,,,,...............}}}}}}}},.....{{{....))}........))))).....

Transcripts

ID Sequence Length GC Content
NM_002704.3 ACUUAUCUGCAGACUUGUAGGCAGCAACUCACCCUCACUCAGAGGUCUU… 1307 nt 0.3565
Summary

The protein encoded by this gene is a platelet-derived growth factor that belongs to the CXC chemokine family. This growth factor is a potent chemoattractant and activator of neutrophils. It has been shown to stimulate various cellular processes including DNA synthesis, mitosis, glycolysis, intracellular cAMP accumulation, prostaglandin E2 secretion, and synthesis of hyaluronic acid and sulfated glycosaminoglycan. It also stimulates the formation and secretion of plasminogen activator by synovial cells. The protein also is an antimicrobial protein with bactericidal and antifungal activity. [provided by RefSeq, Nov 2014]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image