Basic Information

Symbol
PRKAR2B
RNA Class
mRNA
Alias
protein kinase cAMP-dependent type II regulatory subunit beta protein kinase, cAMP-dependent, regulatory, type II, beta protein kinase, cAMP-dependent, regulatory subunit type II beta PRKAR2 RII-BETA cAMP-dependent protein kinase type II-beta regulatory subunit H_RG363E19.2 WUGSC:H_RG363E19.2 cAMP-dependent protein kinase type II-beta regulatory chain
Location (GRCh38)
7:107044627-107161811 UCSC Genome Browser

Secondary Structure

MANE Select
NM_002736.3
Sequence length
3689 nt
GC Content
0.3996

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1027.7 kcal/mol
Thermodynamic ensemble
Free Energy: -1099.4 kcal/mol
Frequency: 0.0000
Diversity: 864.99
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((.(((((.((.((..((((.((.(.((((((((((((((.((((((((((((..((((....))))))))).).)).))))))))....))))).))))).).)).)))).))..(((.((((((((((..((...))..)))..))))))))))(((((...((((((((....))))).)))))))))).))).)).)))))....((.((((...))))))(((.((((((.(((((((((((.((((((((((((((.(((.(.((((((((....))).)).))).).))).)))))))))..((((((.(.((((.....((.((((..(((..((.(..(.(((.(((.....))).))).)..).))..)))..)))))))))).).)))))).((((((.....))))))......))))).))))))).))))(((((((((((((.((.(((((.(((..((((((.((((..(((..((.(((((((...))))))).))......)))........)))))))))).((((((((((((((((......((........)).....((((((...(((((.(((((.((((.....(((..((((((..........(((((((...)))))))(((((((.(((((((((......)))))....))))))))))).....((((.(((((((.(((((........))))).)))....)))).)))))))))).)))...)))).......(((((((.......)))))))(((((((.(((....))).)))))))))))).)))))...)))))).....((((((...)))))))))))))(((......)))....))))).))))......(((((.........))))).)))))))).)).)))...)))).))))))(((....)))..((((((((((.(((((..((((((((......(((((.((((((((...((((.(((..((((((((.(((((..........)))))((((.........))))))))).)))..)))))))..((((((.....(((((((((((..(((((..(((.((.....)).))))))))..)))))))))))......(((((((((((.............((((..((((....(((((((((((.(((((((((..((((((...(((((((((...(((((..(((.((....)).)))..))))))))...........))))))...))))))...)))))))((((((.((((((((((.(((.......)))))))))))))..((.((.((((.(((.....((((((((((...((((..((.(((..((((((..((((((......((.((((((...)))))).))..)))))).......(((((((((((((......((((.((((((((.(((.((............((((((.....))))))((((.(((((((.((....))))))))).)))))).))).)))))))))))).(((((((...(((((((((...(((((((((.((((((((((.((((....)))))))).))))))..))...(((((............((((......))))............)))))....................)))))))...))).))))))....)))))))...((((((((((..((((((..(((((((((........((((...(((((((.(((((.......((((.((((....)))).)))).....)))))))))))).)))).......((((((....))))))))))).))))...))))..))..)))))))))).((((((((((.((....))..)))))))))).((((((...)))))).....((((...((((((.(((((..((((((............(((((...((((....)))).....)))))........(((..(((((..((((.(....((((.((((.(..(((......)))..))))).))))).))))..)))))..))).......((((((..((((.((.(((((....))))))).))))))))))......(((((......)))))...(((((((((....(((.(((((..((((.(((((((((((((....((((((...)))))).....(((((......)))))...((..((((((((((((((.((((((((((.........(((((((........))))))).........)))))..))))).)))).)))).............))))))..))..(((.((.((.((((.(((.......))).)))))).)))))((((((((((.((((..(((((((.....)))))))..)))((((.((((.(((((...............))))).))))..))))(((((((...)))))))......).)).))))))))..)))))))))).))))))).....))))).))))))))))))..........))))))...))))).))))))..))))))))))).))))))..)))))).(((((((((((((.............))))))))..)))))..(((((((..((((..(((....)))...)))).)))))))..................)))...))..)))).))))))))))))).)))).)).))((((((....))))))......((((...(((((.((...(((((((....))))))).)).)))))))))....((((((((...((((.(((((....)))))))))((((((......))))))...))))))))))))))...(((...(((((((((((((.(((.((((......((...(((((((...........)))))))...))))))))))))))))))))))..))))).)))..))))))))....))))))))(((((((.((((....))))(((.(((((((((((((((.......(((((.................)))))..)))))))..................((((....)))).))))).)))))).))))))))))))))))))(((((.(.(((..(((.....))).))).).))))).......(((((((....).))))))........)))))).....(((.......))).)))))))).))))).))))))))..))))).)))..)))))))..(((((..((.(((..((((......((((((((...........(((((((((((((((((((........((((((..(((((((((.(((.....((((........))))..))).))).))))))))))))...(((...)))...)))).)))))))))))))))...((.((((((((((..........))))).))))).)))))))))).......))))..))))).)))))((((((.((((((.............)))))).))))))..(((.(((((((((.......))))).)))).)))...))))))..)))...
Thermodynamic Ensemble Prediction
.(((((,(((((,((.{{..,{{({((.{.,((((((.(((..((((((.((((.....)))).)))}}))..))).)))))),||}|||{..({(({,(({((({..(|(((....|{{((({(((,{({{(((({{(({(,..}||}.})}|}}|}.,((((({.{{({{{{||....)))))}})))))))}}.))).}}.}}}))..,.,{.{|||.,}))},))|,|.|||((({(((((((({{{.((((((((((((({.(({.{,,|||(({({,{{{||,}}.}}}|}}|||,|||}}}}}}.,},}}}))))))}}.....||}||||...}}}.}.}}))))}}}}}},.,,,}})),||.||||||}}..))),})}|}||||||{},,)))))}((((((.....))))))....|||}}}},})}}))).}}}}{((({{(((({{{.{{.{||||,{||,.((((({{((((,,{{{..{|.((((({{...})))))).}}......|||.,.,.,..)))))))))).{({{(((({{((({{({((((((((,,..............|.....})}})))))))}|({(({{,..(((..((((((,.........(((((((...))))))}(((((({,((((,{,,,.....,||,,,..,.))))))))))).....,(((.(((((((.(((((........))))).)))}...,))).))))))))))..((.((....)).))..(((((((.......)))))))(((((((.(({....))).))))))).,))).))))}...})}}}},....((((({...}))))))}}))))(((......)))....}}}}|||}}|,,,,,.(((((.........))))).}}||||||,||,|||,,.}}}},,,}}))|((,...))}..((((((((((.(((((..((((((((......(((((.((((((((...(((({(((,.((((((((.{((((..........)))))((((.,.....,.)))}))))).)))..)))))))..((((((.....(((((((((((..(((((..(((.,{.....,},))))))))..))))))))))).,....(((((((((((.............((((,,(({{....((((((((,,(,(,(((((((..((((((...((((((,(,,..(((((.,(((.({....}).))).,)))))||,...........)))))).,.))))))...))))))|((((((.((((((((((.(((.......)))))))))))))..((.,{{((((.{{,.,,.{((((((((((..,(((,.....{{{..{{{({,..,,{{{,,,||..((.((((((...)))))).)).,||||}|,......(((((((((((((..,...((((.((((((((.{((.((............((((((.....))))))((((.(((((((.((....))))))))).)))))).))).)))))))))))).{{(({{{.,.{((((((((.,.(((((((,{.((((((((({.((((....))))}))).))))))..,,...{{{(({,{{{{......((((......))))...,,,,.{{{{|,,,,.}}}}}.}}}},,|||....))))))}.|.))).)))))}....}})))},...((((((((((..{(((((..(((((((((........((((...(((((((.(((((.......((((.((((....)))).)))).....)))))))))))).)))).......((((((....))))))))))).))))...))))..))..)))))))))).{{((((((((.{{....}}..)))))))))),{((({{...}))))).,,,.{(((...((((((.(((((..((((((.....,,,,,{{{{{(({,.,,.|,,,..,,}.,...,||||{{{{{{{.({,..{{|||,,||||.|,...((((.((((.,,,({{......)))..,)))).))))|,|}}}..})))}.,))),}.....((((({.,((((.{{,(((((....))))))).))))))))))......(((((......)))))...(((((((((....(((.(((((..(((({{{,((((((((((....{(((((...)))))},,,,.,,{||,.......,,},,.{{..{{{|||{{{(((((.((((((((((.........(((((((........))))))).........))))),.})))).))))},}}}.............}))}}}..}}..{{,{((.((.((((.(((.......))).)))))).)))},((((((((((,((((..(((((((.....)))))))..}}}||||,{{{(.({{{{,|....,,,,,|...,}})).)))),.)|}}((((((,...,))))))........)).))))))))..)))))))))).}}))))).....))))).))))))))))))..........)))))).,.))))).))))))..)))}})))))),,)))))..}}}}}}.{((((((((((((.........,...))))))))..))))).,||||{{{,,|||{..{((,,,,}||,..}}},.}}|||||........}}}}}.....,))},)}}}})})).)))))))))))}),)))).)},))|(((((....)))))}..,,,.{(((...(((((.((...(((((((....))))))).)).))))))))}....,,|||,,,...{(((.(((((....)))))))))((((((......))))))..,))}}}}}})))))),..(((...(((((((((((((.{{(,((({.,,...{|,,.{{{{{,,..,,,,{|,..}|}}}},..,),))))))))))))))))))))..)))}).)))..))))))))....})))))))(((((((.{(((....)))|(((.(((((((((((((((.......(((((..........,,.....)))))..)))))))..................((((....)))).))))).)))))),))))))))))))))))))(((((.{.{{{..(((.....))).}},.}.))))).......(((((((....),})))))........)))))).....(((.......))).)))))))).))))).))))))))..))))).)),.,)))))))..,,{{{,{{{{{{{|,|{{{......((((((({......,....{((((((((((((((((((........((((((,.(((((((((.(((.,,..((((.,.....,)))),,))).))),})))))))))))...{({...)))...)))).))))))))))))))}...{(.((((((((((.{{....,,,))))).))))).)})))))))),,,,,...,,,.,),))))))))}((((((.((((((..{{,...,,,..)))))).)))))),,{,{.{{{{(((((.......}}}}).}))).,},...})))}}..,,,...

Transcripts

ID Sequence Length GC Content
NM_002736.3 CGCUCAGCCGCCGCCACCACACGGAGCAGACGCGCGCCGGGAGCCGCGG… 3689 nt 0.3996
Summary

cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image