| ID | Sequence | Length | GC Content |
|---|---|---|---|
| NM_005621.2 | CUUCCUUGGCUCAGUGCCCUUCACCACUGCUGGCUUUUUGCUGUAGCUC… | 485 nt | 0.4619 |
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein is proposed to be involved in specific calcium-dependent signal transduction pathways and its regulatory effect on cytoskeletal components may modulate various neutrophil activities. The protein includes an antimicrobial peptide which has antibacterial activity. [provided by RefSeq, Nov 2014]
No forensic context available.