Basic Information

Symbol
S100A12
RNA Class
mRNA
Alias
S100 calcium binding protein A12 p6 MRP6 CGRP CAAF1 CAGC ENRAGE extracellular newly identified RAGE-binding protein calcium-binding protein in amniotic fluid 1 migration inhibitory factor-related protein 6 neutrophil S100 protein calgranulin C S100 calcium-binding protein A12 (calgranulin C) MRP-6 protein S100-A12 EN-RAGE calcitermin Protein S100-A12 Calcium-binding protein in amniotic fluid 1 Calgranulin-C Extracellular newly identified RAGE-binding protein Migration inhibitory factor-related protein 6 Neutrophil S100 protein S100 calcium-binding protein A12
Location (GRCh38)
1:153373711-153375621 UCSC Genome Browser

Secondary Structure

MANE Select
NM_005621.2
Sequence length
485 nt
GC Content
0.4619

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-131.1 kcal/mol
Thermodynamic ensemble
Free Energy: -140.26 kcal/mol
Frequency: 0.0000
Diversity: 116.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.(((.....((((((((...((((.(((.....)))))))...((((....))))...)))))))).......((((((((..((.((((...((((((((((....((((((...((((((..((((((...............))))))......))))))))))))....(((((.......((((((.(((...))).))).)))...............((((((.((((....)))).))))))...........((((((....((.....)).....)))))).......................(((((((.((......)))))))))........))))).((.(((((.....))))).))...))))))))...))...)))).))..((((((..........))))))......)))))))).)))...))))))...((((..........)))).......
Thermodynamic Ensemble Prediction
{(((((.(((...,{((((((((...((((.(((.....)))))))...((((....))))...))))))))..,,...((((((((..((.((((...((((((((((.{{,((((((...((((((..((((((.,,,,,.....},,.))}})),,.,,.))))))||}}}},...(((((.,.{{..((((((.(((...})).))),,))............,,,((((((.((((....)))).)))))}.....,}}...((((((..,.{{.....}}.....))))))...,,,,..,.............(((((((.((......),)))))))........}}}}}.,..{{{|{.|,..})))),)},.,)))))))}...))...)))).))..((((((..........))))))......)))))))).)))...))))))...({((..........}))).......

Transcripts

ID Sequence Length GC Content
NM_005621.2 CUUCCUUGGCUCAGUGCCCUUCACCACUGCUGGCUUUUUGCUGUAGCUC… 485 nt 0.4619
Summary

The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein is proposed to be involved in specific calcium-dependent signal transduction pathways and its regulatory effect on cytoskeletal components may modulate various neutrophil activities. The protein includes an antimicrobial peptide which has antibacterial activity. [provided by RefSeq, Nov 2014]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image