| ID | Sequence | Length | GC Content |
|---|---|---|---|
| NM_002963.4 | ACACAUCUCACUCAUCCUUCUACUCGUGACGCUUCCCAGCUCUGGCUUU… | 429 nt | 0.4895 |
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein differs from the other S100 proteins of known structure in its lack of calcium binding ability in one EF-hand at the N-terminus. The protein is overexpressed in hyperproliferative skin diseases, exhibits antimicrobial activities against bacteria and induces immunomodulatory activities. [provided by RefSeq, Nov 2014]
No forensic context available.