Basic Information

Symbol
AVP
RNA Class
mRNA
Alias
arginine vasopressin ADH antidiuretic hormone neurophysin II diabetes insipidus neurohypophyseal prepro-AVP-NP II prepro-arginine-vasopressin-neurophysin II copeptin ARVP AVP-NPII AVRP VP vasopressin-neurophysin 2-copeptin vasopressin-neurophysin II-copeptin Vasopressin-neurophysin 2-copeptin
Location (GRCh38)
20:3082556-3084724 UCSC Genome Browser

Secondary Structure

MANE Select
NM_000490.5
Sequence length
619 nt
GC Content
0.7189

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-295.2 kcal/mol
Thermodynamic ensemble
Free Energy: -305.56 kcal/mol
Frequency: 0.0000
Diversity: 187.52
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.............(((.((.((((((((((.....)))))))))).((((...)))).......((.((((.((.((((((.((((((.(((((((((((((((((((((..(.(((((...((((((.((((((((......)))...(((.....))).(((((.((((((((((((((......))))))...))).))))).)))))(((((((.(((((...)))))...))))))).))))).))))))...))).)).)..)))).))..)))))))))....(((.((......)).)))...)))))).)))).)).)))))))))))).)).((((((....)))))).(((((((..(.((..(((((((((..((.(((((.((((.(((.((((............)))).)))..)).))))).))..)).)))))))))((..((((.((((((((((.....((..(((((((.((.(((.(..(((((......))))).).)))..)))))).)))..)).....).)))))).))).))))..))((((((.....)))))))).)..)))))))((((.........)))).)).))).
Thermodynamic Ensemble Prediction
.....,,......(({,{({((((((((((.....)))))))))).((((...))))....,..{{.{(((,({{(((({(.{(((({.((((({{((((((((((((((..{,{{,,,...(((((|.((((({((,.,,((||,.{{(((,.,,,||,,{||,|,||{{||||{{{{||,.}}}}),})))},.,||{{|,||||||||(((((((.(((((...)))))...)))))))}}}}})},)))))}}})))})).},.)))).})..))))))))}....||{,{{,,,,..,}|}}},..)))))).)))),,),)))}||||}}}).)).((((((....)))))}.{(((({{..{.{{..(((((((((..,,.(((((.((((.(((.((((..........,.)))).)))..))},)))).))..,).)))))))))((..((((.((((((((((.....((..{((((((.((.(((.(..(((((......))))).).)))..))))))))})..)).....).)))))).))).))))..))((((((.....))))))}),}..))))))}{(({.........)))),...})).

Transcripts

ID Sequence Length GC Content
NM_000490.5 ACAGAGCCACCAAGCAGUGCUGCAUACGGGGUCCACCUGUGUGCACCAG… 619 nt 0.7189
Summary

This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin is a posterior pituitary hormone that is synthesized in the supraoptic nucleus and paraventricular nucleus of the hypothalamus. Along with its carrier protein, neurophysin 2, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis where it is either stored or secreted into the bloodstream. The precursor is thought to be activated while it is being transported along the axon to the posterior pituitary. Arginine vasopressin acts as a growth factor by enhancing pH regulation through acid-base transport systems. It has a direct antidiuretic action on the kidney, and also causes vasoconstriction of the peripheral vessels. This hormone can contract smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. Mutations in this gene cause autosomal dominant neurohypophyseal diabetes insipidus (ADNDI). This gene is present in a gene cluster with the related gene oxytocin on chromosome 20. [provided by RefSeq, Nov 2015]

Forensic Context

No forensic context available.

Genomic Tracks
Track Image