Basic Information

Symbol
CCL22
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 22 MDC A-152E5.1 DC/B-CK STCP-1 ABCD-1 SCYA22 Small Inducible Cytokine Subfamily A (Cys-Cys), Member 22 Chemokine (C-C Motif) Ligand 22 Macrophage-Derived Chemokine C-C Motif Chemokine 22 CC Chemokine STCP-1 MDC(1-69) MGC34554 Stimulated T Cell Chemotactic Protein 1 Stimulated T-Cell Chemotactic Protein 1 Small Inducible Cytokine A22 Small-Inducible Cytokine A22
Location (GRCh38)
Forensic tag(s)
Individual identification Wound age identification Other applications

MANE select

Transcript ID
NM_002990.5
Sequence length
2917.0 nt
GC content
0.5283

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-978.30 kcal/mol
Thermodynamic ensemble
Free energy: -1026.70 kcal/mol
Frequency: 0.0000
Diversity: 487.15
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((...(((((((.(((....(((((((((.((.((((.((((.((((...........((....))............)))))))).)))).))......(((((((....((((((....(((((....((((....)))))))))....)).))))....))))))).........(((..((((((.(..(.((.((((.(........).)))))).)..).))))))....)))...(((((.(((((((((((((((.....((.((.((((((((((((((....)))......(((((((......((((....))))((((.((..(((..((((((((((((...((((((((((....(((..((((....(((.((....(((((((((....))).))....((((((((......((((.........(((((.((.((...(((......)))....)).)).))))).........(((((...........((((((.((.(......).)).))))))((((((.......))).)))...........(((((.((((.((....((((((((....(((..((.......))..)))..)))).))))...))))))...)))))..(((((.((((..((((((((((((.((...((((((((.((((((..(((.....))).....))))))..((((((((..((....((((.((((..(((((.((((...))))))))))))).)))).....))...))))))))....((((((.......(((.......)))......)))))).....)).))))))................((((....(((...((((((.((((((.((...(((((((((((..(((((((((((((((......)))))).......((((((((((........))))))).)))......)))).)))))..))).))...(((((((((((.((....(((((((.......))).))))....)).)))))((((................))))......((((..(((((....)))))..............))))(((..((((((..((....(((((((((.(((((((((((((((.....(((((..(((........))).......(((...................)))..((((..(((((..((..(((((....((((.(....((((((((...((((.......(((.(((((((((((((.(((((((..(.((((((..((((((.....((((((((......(((....)))......))))))))...(((.((((...)))).))).))))))..........(((((((((((.(((((...((((....))))...))((((...((((((((.....)).))))))......)))).))))))....))))))))............................................)))))))..))))).))..)))))....)))).)))).)))........)))).))))).)))....)))))))))).)))))))..))))...((((((..(....)..))))))..((((((.((..(((((....).))))..)).))))))......)))))....))))))))...))))))).)))))))))....))..))))))..)))..............))))))(((.((.((.((((.....(((((..(((((((((.(((((.((((((...........((((((...)))))).((.......(((((((((...((((.(.(((.((((((.((((((((((..((((((((...(((((.(((......)))))))).....)))))(((((((((((((.(((.....(((((((((....((((...........((((((((.........))).)))))...((.((((.....)))).))..))))....))).)))))).......)))))))).....((((....)))).))))))))......)))..)).))).....))))).))))))))).))))))))))))))......))....))).))).))))).)))))))))...))))).....)))).)))).)))..))))))...)).))))))...))))))....))).....)))).((((....)))).)).)).)))).))))))..)))).)))))..))))).......(((.....))).))))..)))))))).))))....)).))).....))))..)))......)))))))))).............((((((((((((((..((((((((((...(((((((........)))))))...))).........((((((......))))))..))))).....((((((....))))))(((....((((((...........))))))...)))..))..)))))))))).)))).((((((((.........)))))))).)))))))).))))..(((((((((..((.((((((((....((((((((((..(((.......)))..))))))))))...))))))))...))..)))))))))....)))..))))))..))))))).))))))))))))).)).............((((.....)))).........)))))....((((((...((.......((((.......)))).....)))))))).)))))))))).))))).))))))))).)))))))...))).)))).(((.......)))..........
Thermodynamic Ensemble Prediction
((((...(((((((.{{(,,..(((((((((,((,{(((.((({.((((,,.,.......||,.,.)}..}...,,,.,}))}))|||,}}}}.||,...{.(((((((....((((((....(((((..,.((({...,)))})))))....)).))))....))))))).,,}},,,.(((..((((((.{..(.((.((((.(.,....,.}.)))))).),.}.))))))....)))...(((((.(((((((((({{{{{.....((.((.((((((((((({((....}))......(((((((......((((....))))((((.((..(((..(((((((((((({,.((((((((((....(((..((((....(((.((....(((((((((....))).))....((((((((......({{,...,.....(((((.({,((...{((......))).}..)}.)).))))}.........(((((......,..{{((((((.((.,......).)).))))))}|,,,{.......}||,|,......,},,..(((((.((((.((....((((((((....(((,.((.......))..)))..)))).))))...))))))...)))))..(((((.((((..((((((((((({.{({{.{{{(((((.((((((..{((.....))}.....))))))..((((((((..,,....((((.((((..(((((.((((...))))))))))))).)))).....,}...))))))))....((((((.......(((.......)))...,..)))))).....}},}}}}}}....,|,.|....{{,((((....(((.{.((((((.((((((.((...(((((((((((..,{{((((,.((((((......))))))..},.},{{((((((((.....,..)))))))},},.....,}|||{}}}}|.,|||,}}.,,|||{,((({{{.||,,..(((((((.......)))))}))....}},|||||((({................,}},............(((((....)))))..............,|||({{..((((((..((....(((((((((.(((((((((((((((.....(((((..(((........))}.............................)))}.((((..(((((..((..(((((....((((.{,...((((((((...((((.,,{...(((.(((((((((((((.(((((((..({((((((,,(({{{{,}||,((((((((......(((....}}},,,...))))))))...,,,.{,,,...,}}},}}}.))||}}..........(((((((((((.((({,...((((....))))...,,{{{|...((((((((.....)).))))))....,,))}),))))))....))))))))............................................)))))))..))))).))..)))))},..}})).)))).))).,,},...)))).)))))},))....}))))))))).)))))))..))))...((((((..(....)..))))))..((((((.((..(((((....).))))..)).))))))......)))))....))))))))...))))))).)))))))))....))..))))))..}||{{.......,,.,,|||||,....}}})}.|{||.....(((((..(((((((((.(((((.((((((.......,,..,{((((,,.|}}}}}.{{.......(((((((((...((((.(.(((.((((((.((((((((((..((((((((...(((((.(((......)))))))).....))))){((((((((,,(((((,.....(((((((((....((((...........((((((((.........))).)))))||.((.{{{{...,,)}}}.)}..))))....))).)))))).......||}||||....,,||||...,))))})))))))}......}))..)),})).....))))).))))))))),}))))))))))))),.....)}....))).))).))))).)))))))))...))))).,...))))}))))))))}.))))))...)).))))))...)))))).}..))).....)))),|{||.,,,))},})).)),}))),,)))))..)))).)))))..)))))..,,...(((.....))).))}...)))))))).))))....)).))).....))))..)))......)))))))))),..,...,,,,..{(((((((((((((..,,((((((((...(((((((,......})))))))...))).........{(((((......}))))}..)))))....{((((((....))))))}((.{{{((((,{...,.......})}},}.}))))},))..)))))))))).))),.((((((((.........))))))))..)))))))}})))..(((((((((..((.((((((((....((((((((((..(((.......)))..))))))))))...))))))))...))..)))))))))....)))..))))))..))))))).))))))))))))).)).,...........{{||,....}}}}.........)))),.,,.{(((({...,|,.},..,|{{{.....,,))||......,}))))),)))))))))).))))).))))))))),}}})))}..,))).)))).(((.......)))..........

Transcripts

ID Sequence Length GC content
GCAGACACCUGGGCUGAGACAUACAGGACAGAGCAUGGAUCGCCUACAG… 2917 nt 0.5283
Summary

This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 16. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for monocytes, dendritic cells, natural killer cells and for chronically activated T lymphocytes. It also displays a mild activity for primary activated T lymphocytes and has no chemoattractant activity for neutrophils, eosinophils and resting T lymphocytes. The product of this gene binds to chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated T lymphocytes to inflammatory sites and other aspects of activated T lymphocyte physiology. [provided by RefSeq, Sep 2014]

Forensic Context

A study in rats demonstrated that the CCL22 is significantly upregulated in adult cardiac fibroblasts compared to both neonatal and fetal cells, indicating its role in age-dependent increases in immune and inflammatory functions [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021]. In humans, population transcriptomic studies have identified the CCL22 as differentially expressed between European and African populations in lymphoblastoid cell lines, associating it with immunological response and highlighting its potential for forensic population differentiation [Daca-Roszak et al. DOI:10.1007/s13353-019-00510-1]. A study in mice demonstrated that the CCL22 was among the most upregulated genes in skeletal muscle following incised injury, showing a 1409.222-fold increase at 12 hours post-injury with persistent upregulation until 36 hours and peak expression at 36 hours [Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027]. In a separate study in rats, the CCL22 was significantly upregulated in the piriform cortex at all time points following sarin-induced seizure onset, with expression peaking at 3 hours [Spradling et al. DOI:10.1186/1742-2094-8-83].