| ID | Sequence | Length | GC Content |
|---|---|---|---|
| NM_006664.4 | AAGGAAGAGUCUAGGCUGAGCAACAUGAAGGGGCCCCCAACCUUCUGCA… | 417 nt | 0.5348 |
This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene is chemotactic for skin-associated memory T lymphocytes. This cytokine may also play a role in mediating homing of lymphocytes to cutaneous sites. It specifically binds to chemokine receptor 10 (CCR10). Studies of a similar murine protein indicate that these protein-receptor interactions have a pivotal role in T cell-mediated skin inflammation. [provided by RefSeq, Sep 2014]
No forensic context available.